Mutagenetix > Incidental Mutations

Incidental Mutation 'R5909:Bdp1'

460875

Institutional Source

Beutler Lab

Gene Symbol

Bdp1

Ensembl Gene

ENSMUSG00000049658

Gene Name

B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB

Synonyms

TAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik

MMRRC Submission

044106-MU

Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5909 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

100017994-100104070 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100092286 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 278 (V278A)

Ref Sequence

ENSEMBL: ENSMUSP00000105005 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]

Predicted Effect

probably benign
Transcript: ENSMUST00000038104
AA Change: V278A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: V278A

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	375	399	N/A	INTRINSIC
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	3.56e-18	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	3.56e-18	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109379
AA Change: V278A

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: V278A

Domain	Start	End	E-Value	Type
low complexity region	25	45	N/A	INTRINSIC
low complexity region	81	92	N/A	INTRINSIC
low complexity region	147	164	N/A	INTRINSIC
low complexity region	231	242	N/A	INTRINSIC
SANT	301	349	1.52e-4	SMART
coiled coil region	457	487	N/A	INTRINSIC
internal_repeat_1	593	895	4.79e-19	PROSPERO
coiled coil region	1013	1038	N/A	INTRINSIC
internal_repeat_1	1253	1612	4.79e-19	PROSPERO
low complexity region	1718	1733	N/A	INTRINSIC
low complexity region	1763	1774	N/A	INTRINSIC
low complexity region	1912	1921	N/A	INTRINSIC
low complexity region	2185	2199	N/A	INTRINSIC
low complexity region	2335	2346	N/A	INTRINSIC
low complexity region	2398	2412	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167203

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts8	T	C	9: 30,961,928	S810P	probably benign	Het
Adcy7	A	T	8: 88,325,496	I931F	probably damaging	Het
Alcam	G	T	16: 52,290,993	Q248K	probably benign	Het
Astn1	A	C	1: 158,601,937	R750S	probably damaging	Het
Atp1a2	A	T	1: 172,287,230	N329K	probably damaging	Het
Bcl6	A	G	16: 23,972,806	V266A	probably benign	Het
Ccdc162	T	C	10: 41,561,115	E493G	probably damaging	Het
Cpvl	T	C	6: 53,932,428	Y241C	probably damaging	Het
Ddx55	T	C	5: 124,566,850	M390T	probably benign	Het
Ero1lb	A	G	13: 12,579,258	E102G	probably benign	Het
Etnk1	A	G	6: 143,197,438	D273G	probably benign	Het
Exoc3	A	G	13: 74,199,524	V109A	probably damaging	Het
F830016B08Rik	T	A	18: 60,300,019	I58N	probably damaging	Het
Fancd2	T	A	6: 113,561,711	V589E	probably benign	Het
Fbll1	G	A	11: 35,798,332	R35C	unknown	Het
Fnbp1	A	G	2: 31,048,199		probably null	Het
Glce	G	T	9: 62,060,144	A575D	probably damaging	Het
Gm14548	G	A	7: 3,897,622	T43I	probably damaging	Het
Ift20	T	A	11: 78,540,041	M70K	possibly damaging	Het
Impg2	T	C	16: 56,258,136	V487A	probably damaging	Het
Isx	A	G	8: 74,892,798	D206G	probably benign	Het
Jak3	A	G	8: 71,684,231	I684V	possibly damaging	Het
Kdm5d	G	A	Y: 941,306	S1169N	probably benign	Het
Krt35	A	T	11: 100,095,813	L125Q	probably damaging	Het
Lama4	G	A	10: 39,072,859	A873T	probably benign	Het
Lrch4	T	C	5: 137,633,865	S74P	possibly damaging	Het
Maneal	A	T	4: 124,857,173	Y263*	probably null	Het
Mcat	C	T	15: 83,547,915	A251T	probably benign	Het
Mup3	T	G	4: 62,086,007	T90P	probably benign	Het
Mybpc2	G	A	7: 44,507,091	A812V	probably damaging	Het
Naa15	T	C	3: 51,460,064	F503L	probably damaging	Het
Nudt8	T	C	19: 4,000,727	L25S	possibly damaging	Het
Oas1e	A	T	5: 120,788,907	V245D	probably damaging	Het
Ofcc1	A	G	13: 40,263,578	M109T	possibly damaging	Het
Olfr1179	A	T	2: 88,402,191	F248I	probably damaging	Het
Olfr48	A	G	2: 89,844,391	V194A	possibly damaging	Het
Phkb	G	T	8: 86,021,447		probably null	Het
Pidd1	A	C	7: 141,441,270	L365R	probably damaging	Het
Pkd1l2	G	A	8: 117,024,056	R1739C	probably benign	Het
Pkdrej	A	T	15: 85,818,296	D1146E	possibly damaging	Het
Pkhd1l1	G	T	15: 44,526,763	W1425L	probably damaging	Het
Plxna4	A	G	6: 32,517,246	L145P	probably damaging	Het
Plxnd1	G	T	6: 115,968,688	D941E	probably benign	Het
Prdm13	G	T	4: 21,683,894	Q126K	unknown	Het
Rbm25	T	A	12: 83,681,588	V837E	probably damaging	Het
Rcc2	T	A	4: 140,717,068	Y357N	probably damaging	Het
Siglec1	A	T	2: 131,077,964	N882K	probably damaging	Het
Sox13	A	G	1: 133,383,889	I535T	probably benign	Het
Srrm2	T	C	17: 23,821,317	S2408P	probably benign	Het
Stat3	G	A	11: 100,903,730	T251I	probably benign	Het
Sulf1	A	T	1: 12,858,815	D102V	possibly damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Tmem145	G	T	7: 25,308,193	L208F	possibly damaging	Het
Trim17	A	T	11: 58,968,680	E240V	probably damaging	Het
Trim43b	A	T	9: 89,085,398	I395K	possibly damaging	Het
Trmt61a	C	A	12: 111,680,858	H130N	probably damaging	Het
Unc5b	A	C	10: 60,772,359	L654R	probably damaging	Het
Vmn1r66	A	T	7: 10,274,342	S255T	probably benign	Het
Ylpm1	C	T	12: 85,040,886	P1148L	probably damaging	Het
Zbtb10	T	C	3: 9,280,049	F677S	probably benign	Het
Zfp493	T	A	13: 67,786,598	C223*	probably null	Het

Other mutations in Bdp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Bdp1	APN	13	100098510	missense	probably damaging	1.00
IGL00096:Bdp1	APN	13	100060865	missense	possibly damaging	0.61
IGL00160:Bdp1	APN	13	100061198	missense	probably benign	0.00
IGL00924:Bdp1	APN	13	100097579	missense	possibly damaging	0.89
IGL01337:Bdp1	APN	13	100056192	missense	probably benign	0.00
IGL01344:Bdp1	APN	13	100078080	missense	probably benign	0.06
IGL01347:Bdp1	APN	13	100070203	missense	possibly damaging	0.79
IGL01620:Bdp1	APN	13	100084205	splice site	probably benign
IGL01871:Bdp1	APN	13	100066053	missense	probably benign	0.01
IGL02008:Bdp1	APN	13	100023827	missense	possibly damaging	0.92
IGL02112:Bdp1	APN	13	100037800	missense	probably benign	0.02
IGL02214:Bdp1	APN	13	100041535	missense	probably benign	0.00
IGL02236:Bdp1	APN	13	100060891	missense	probably benign
IGL02307:Bdp1	APN	13	100093438	missense	probably damaging	1.00
IGL02364:Bdp1	APN	13	100055308	splice site	probably benign
IGL02415:Bdp1	APN	13	100089408	missense	probably damaging	0.96
IGL02601:Bdp1	APN	13	100098514	missense	possibly damaging	0.72
IGL02605:Bdp1	APN	13	100078115	critical splice acceptor site	probably null
IGL02664:Bdp1	APN	13	100051539	missense	probably benign	0.29
IGL02738:Bdp1	APN	13	100051353	missense	probably benign	0.26
IGL02754:Bdp1	APN	13	100060973	missense	possibly damaging	0.94
IGL02967:Bdp1	APN	13	100042270	missense	possibly damaging	0.92
IGL02974:Bdp1	APN	13	100055292	missense	probably benign	0.00
IGL03156:Bdp1	APN	13	100061036	missense	probably benign	0.44
IGL03166:Bdp1	APN	13	100035800	missense	probably benign	0.28
IGL03232:Bdp1	APN	13	100051481	missense	probably damaging	1.00
D3080:Bdp1	UTSW	13	100023621	missense	probably benign	0.02
R0115:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0481:Bdp1	UTSW	13	100041454	missense	probably benign	0.28
R0619:Bdp1	UTSW	13	100037858	missense	probably benign	0.00
R0730:Bdp1	UTSW	13	100058951	splice site	probably benign
R0744:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R0833:Bdp1	UTSW	13	100035825	missense	probably benign	0.01
R1307:Bdp1	UTSW	13	100049763	missense	possibly damaging	0.89
R1325:Bdp1	UTSW	13	100099008	missense	probably damaging	0.97
R1346:Bdp1	UTSW	13	100078755	nonsense	probably null
R1644:Bdp1	UTSW	13	100060940	missense	probably benign	0.03
R1670:Bdp1	UTSW	13	100027433	critical splice donor site	probably null
R1836:Bdp1	UTSW	13	100035145	missense	probably benign
R1869:Bdp1	UTSW	13	100042201	missense	probably damaging	0.99
R1920:Bdp1	UTSW	13	100098589	missense	probably benign	0.30
R1944:Bdp1	UTSW	13	100074381	splice site	probably null
R2030:Bdp1	UTSW	13	100061189	missense	probably benign	0.00
R2069:Bdp1	UTSW	13	100050988	missense	probably benign	0.00
R2180:Bdp1	UTSW	13	100061405	small insertion	probably benign
R2263:Bdp1	UTSW	13	100066037	missense	probably damaging	0.96
R2277:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2277:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2278:Bdp1	UTSW	13	100061330	missense	probably benign	0.05
R2278:Bdp1	UTSW	13	100061339	missense	probably damaging	1.00
R2336:Bdp1	UTSW	13	100053002	missense	probably damaging	0.99
R2380:Bdp1	UTSW	13	100060370	missense	probably benign	0.08
R3154:Bdp1	UTSW	13	100049814	missense	probably damaging	1.00
R4212:Bdp1	UTSW	13	100059585	missense	probably benign
R4322:Bdp1	UTSW	13	100092223	missense	probably damaging	0.97
R4414:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4415:Bdp1	UTSW	13	100030861	missense	probably damaging	0.99
R4764:Bdp1	UTSW	13	100056267	missense	probably damaging	0.99
R4766:Bdp1	UTSW	13	100049868	missense	probably damaging	0.96
R4888:Bdp1	UTSW	13	100051119	missense	probably benign	0.26
R4914:Bdp1	UTSW	13	100056336	missense	probably benign	0.28
R4917:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R4918:Bdp1	UTSW	13	100055205	missense	probably damaging	0.99
R5170:Bdp1	UTSW	13	100030794	nonsense	probably null
R5266:Bdp1	UTSW	13	100067535	missense	probably benign	0.33
R5312:Bdp1	UTSW	13	100097601	splice site	probably null
R5420:Bdp1	UTSW	13	100066043	missense	possibly damaging	0.88
R5486:Bdp1	UTSW	13	100098510	missense	probably damaging	1.00
R5913:Bdp1	UTSW	13	100051104	missense	probably benign	0.41
R6018:Bdp1	UTSW	13	100038224	missense	probably benign	0.00
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6037:Bdp1	UTSW	13	100027449	missense	possibly damaging	0.65
R6700:Bdp1	UTSW	13	100025528	missense	probably benign	0.00
R6969:Bdp1	UTSW	13	100074531	missense	probably damaging	0.97
R6972:Bdp1	UTSW	13	100037761	missense	probably null	1.00
R6996:Bdp1	UTSW	13	100043813	missense	probably damaging	1.00
R7043:Bdp1	UTSW	13	100078707	missense	probably benign	0.03
R7060:Bdp1	UTSW	13	100059494	missense	probably damaging	1.00
R7105:Bdp1	UTSW	13	100070181	missense	probably damaging	1.00
R7155:Bdp1	UTSW	13	100061151	missense	possibly damaging	0.93
R7175:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7177:Bdp1	UTSW	13	100049970	missense	probably damaging	0.97
R7327:Bdp1	UTSW	13	100041532	missense	probably damaging	0.97
R7512:Bdp1	UTSW	13	100050949	missense	probably benign	0.03
R7562:Bdp1	UTSW	13	100025541	missense	probably benign	0.04
R7583:Bdp1	UTSW	13	100049812	missense	probably damaging	1.00
R7788:Bdp1	UTSW	13	100055251	missense	possibly damaging	0.64
R7842:Bdp1	UTSW	13	100099129	missense	probably damaging	1.00
R7850:Bdp1	UTSW	13	100092324	missense	probably damaging	1.00
R7904:Bdp1	UTSW	13	100041436	missense	probably benign	0.37
R7925:Bdp1	UTSW	13	100099129	missense	probably damaging	1.00
R7933:Bdp1	UTSW	13	100092324	missense	probably damaging	1.00
R7987:Bdp1	UTSW	13	100041436	missense	probably benign	0.37
RF003:Bdp1	UTSW	13	100060449	missense	probably benign	0.31
RF003:Bdp1	UTSW	13	100060450	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- AAACCAACGTGGCAGGTTCC -3'
(R):5'- ACAGGTTGGCATTTATTTCTGTACC -3'

Sequencing Primer
(F):5'- ACGTGGCAGGTTCCATTTTATTTAC -3'
(R):5'- CTGTACTAAGTGCTGTGTAAA -3'

Posted On

2017-02-28