Incidental Mutation 'R5910:Olfr1412'
ID460891
Institutional Source Beutler Lab
Gene Symbol Olfr1412
Ensembl Gene ENSMUSG00000046300
Gene Nameolfactory receptor 1412
SynonymsGA_x6K02T2R7CC-81165686-81164721, MOR208-4
MMRRC Submission 044107-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5910 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location92585779-92591375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92588707 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 126 (Y126H)
Ref Sequence ENSEMBL: ENSMUSP00000150943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062964] [ENSMUST00000190505]
Predicted Effect probably damaging
Transcript: ENSMUST00000062964
AA Change: Y126H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060291
Gene: ENSMUSG00000046300
AA Change: Y126H

DomainStartEndE-ValueType
transmembrane domain 10 27 N/A INTRINSIC
Pfam:7tm_4 38 314 7.8e-47 PFAM
Pfam:7tm_1 48 321 1.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190505
AA Change: Y126H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204141
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 95% (93/98)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,668,117 N976D probably damaging Het
Adamts1 G A 16: 85,802,149 R188W probably benign Het
Adcy4 A T 14: 55,779,013 V327D probably damaging Het
Alg8 T C 7: 97,390,286 I408T possibly damaging Het
Ankib1 T C 5: 3,693,217 S933G probably benign Het
Ap2a2 A G 7: 141,598,778 D106G probably damaging Het
Arhgap22 A T 14: 33,366,615 H351L probably damaging Het
Arhgef2 A G 3: 88,635,020 Y310C probably damaging Het
Atm A T 9: 53,448,080 S2804R probably damaging Het
Baz2b A G 2: 59,977,426 L163P possibly damaging Het
Bcl2l12 C T 7: 44,996,543 probably null Het
Cdh23 A G 10: 60,377,821 V1495A possibly damaging Het
Cep78 A G 19: 15,969,128 S447P possibly damaging Het
Cfap43 G A 19: 47,780,271 T778I possibly damaging Het
Cfap54 A T 10: 93,065,181 N170K probably damaging Het
Cmya5 A T 13: 93,092,643 L1979Q probably damaging Het
Col15a1 A T 4: 47,289,514 E846D probably damaging Het
Col5a1 A G 2: 28,036,888 K308E possibly damaging Het
Dcst1 T A 3: 89,350,424 T680S possibly damaging Het
Dsp T C 13: 38,192,469 L1410P possibly damaging Het
Edem3 T A 1: 151,770,827 probably null Het
Eif4e2 T A 1: 87,220,974 Y64N probably damaging Het
Fcgbp C T 7: 28,085,503 probably benign Het
Gm11639 A T 11: 104,690,934 E34V probably benign Het
Gm7275 A T 16: 48,073,463 noncoding transcript Het
Grin3b G T 10: 79,973,021 V202L probably benign Het
Gsdmc4 G A 15: 63,895,252 S223F possibly damaging Het
Hbp1 T C 12: 31,937,652 H183R probably benign Het
Hectd3 A G 4: 117,002,134 M652V probably benign Het
Hist1h2bm A G 13: 21,722,300 N68S probably benign Het
Hmgxb4 T C 8: 74,999,565 F13L probably benign Het
Hnrnpab T C 11: 51,601,454 K271R probably benign Het
Ilvbl A T 10: 78,577,113 K156N probably benign Het
Iqce A T 5: 140,702,218 probably benign Het
Itpr2 C A 6: 146,329,571 V1194L probably benign Het
Kif18b A G 11: 102,913,544 F384L probably benign Het
Klf14 A G 6: 30,957,839 Y287H probably benign Het
Klhl6 A G 16: 19,957,094 M238T probably benign Het
Lbp G A 2: 158,324,557 V344I probably benign Het
Lrp12 T C 15: 39,876,043 probably null Het
Mapk7 T A 11: 61,493,621 M1L probably benign Het
Muc5b A G 7: 141,861,311 T2665A possibly damaging Het
Ncln A T 10: 81,496,078 probably null Het
Nfxl1 T C 5: 72,540,365 R347G probably benign Het
Npnt C A 3: 132,906,418 C231F probably damaging Het
Nrap T A 19: 56,342,311 H1070L probably benign Het
Nrxn1 G T 17: 90,704,318 Y294* probably null Het
Olfr1261 A G 2: 89,993,438 D15G probably benign Het
Otog A G 7: 46,298,598 H2341R possibly damaging Het
Paqr3 T C 5: 97,096,028 probably null Het
Pcdhb11 T C 18: 37,423,743 F709L probably benign Het
Phf12 G A 11: 78,027,398 R812Q probably damaging Het
Polr2a A T 11: 69,746,870 L216Q probably damaging Het
Polrmt A G 10: 79,743,497 L140P probably benign Het
Pou2f3 C T 9: 43,134,474 probably null Het
Prkcd A T 14: 30,595,981 N548K probably benign Het
Pygb A G 2: 150,815,700 D361G probably benign Het
Rpl9 A T 5: 65,388,701 probably benign Het
Rubcnl A T 14: 75,035,472 T211S probably benign Het
Rusc1 C T 3: 89,091,720 G252S probably benign Het
Scnn1g A G 7: 121,738,095 T60A probably damaging Het
Sipa1l2 T G 8: 125,491,684 T305P probably benign Het
Slc18b1 T A 10: 23,824,667 probably benign Het
Sp100 G A 1: 85,681,140 probably null Het
Tekt5 A T 16: 10,387,153 probably null Het
Tlnrd1 T A 7: 83,884,485 probably benign Het
Tpcn1 A G 5: 120,547,397 probably benign Het
Tpcn2 T C 7: 145,260,982 I461V probably benign Het
Traf3ip1 A G 1: 91,527,745 K643E probably damaging Het
Trim33 T C 3: 103,344,576 C914R probably damaging Het
Trip11 G A 12: 101,883,479 T1442I probably damaging Het
Ttll6 A G 11: 96,135,589 M107V possibly damaging Het
Uap1l1 A G 2: 25,363,433 probably benign Het
Ube3b T A 5: 114,415,309 I914N possibly damaging Het
Usp24 A G 4: 106,380,468 T1107A probably damaging Het
Usp40 A T 1: 87,968,400 C811* probably null Het
Vps11 T C 9: 44,359,135 probably null Het
Wdr91 A T 6: 34,891,487 I433N possibly damaging Het
Zfp770 G C 2: 114,196,232 S452* probably null Het
Other mutations in Olfr1412
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Olfr1412 APN 1 92588972 missense possibly damaging 0.52
IGL02177:Olfr1412 APN 1 92588757 missense possibly damaging 0.96
IGL02507:Olfr1412 APN 1 92588926 missense possibly damaging 0.68
IGL02888:Olfr1412 APN 1 92589203 missense probably damaging 1.00
IGL03001:Olfr1412 APN 1 92588551 missense probably damaging 1.00
R1771:Olfr1412 UTSW 1 92589115 missense probably benign 0.03
R1780:Olfr1412 UTSW 1 92588389 missense probably benign 0.01
R2215:Olfr1412 UTSW 1 92588986 missense probably benign 0.00
R2437:Olfr1412 UTSW 1 92588966 missense possibly damaging 0.46
R3176:Olfr1412 UTSW 1 92588813 missense probably benign 0.32
R3177:Olfr1412 UTSW 1 92588813 missense probably benign 0.32
R3276:Olfr1412 UTSW 1 92588813 missense probably benign 0.32
R3277:Olfr1412 UTSW 1 92588813 missense probably benign 0.32
R4475:Olfr1412 UTSW 1 92588579 missense probably benign 0.00
R4892:Olfr1412 UTSW 1 92588921 missense probably benign 0.05
R6808:Olfr1412 UTSW 1 92589046 missense probably damaging 0.99
R7130:Olfr1412 UTSW 1 92588912 missense probably benign 0.10
R7476:Olfr1412 UTSW 1 92589264 missense probably benign
Z1088:Olfr1412 UTSW 1 92588551 missense probably damaging 1.00
Z1177:Olfr1412 UTSW 1 92588378 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAACCTCACCATGATTGTG -3'
(R):5'- AATGGTCGATGTGATTGGAGCC -3'

Sequencing Primer
(F):5'- CATGATTGTGGTCATCACCCTGG -3'
(R):5'- TCGATGTGATTGGAGCCACAGAAG -3'
Posted On2017-02-28