Incidental Mutation 'R5910:Pygb'
ID460899
Institutional Source Beutler Lab
Gene Symbol Pygb
Ensembl Gene ENSMUSG00000033059
Gene Namebrain glycogen phosphorylase
Synonyms
MMRRC Submission 044107-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R5910 (G1)
Quality Score181
Status Validated
Chromosome2
Chromosomal Location150786735-150831758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150815700 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 361 (D361G)
Ref Sequence ENSEMBL: ENSMUSP00000035743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045441]
Predicted Effect probably benign
Transcript: ENSMUST00000045441
AA Change: D361G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035743
Gene: ENSMUSG00000033059
AA Change: D361G

DomainStartEndE-ValueType
Pfam:Phosphorylase 113 829 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154366
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 95% (93/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycogen phosphorylase found predominantly in the brain. The encoded protein forms homodimers which can associate into homotetramers, the enzymatically active form of glycogen phosphorylase. The activity of this enzyme is positively regulated by AMP and negatively regulated by ATP, ADP, and glucose-6-phosphate. This enzyme catalyzes the rate-determining step in glycogen degradation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,668,117 N976D probably damaging Het
Adamts1 G A 16: 85,802,149 R188W probably benign Het
Adcy4 A T 14: 55,779,013 V327D probably damaging Het
Alg8 T C 7: 97,390,286 I408T possibly damaging Het
Ankib1 T C 5: 3,693,217 S933G probably benign Het
Ap2a2 A G 7: 141,598,778 D106G probably damaging Het
Arhgap22 A T 14: 33,366,615 H351L probably damaging Het
Arhgef2 A G 3: 88,635,020 Y310C probably damaging Het
Atm A T 9: 53,448,080 S2804R probably damaging Het
Baz2b A G 2: 59,977,426 L163P possibly damaging Het
Bcl2l12 C T 7: 44,996,543 probably null Het
Cdh23 A G 10: 60,377,821 V1495A possibly damaging Het
Cep78 A G 19: 15,969,128 S447P possibly damaging Het
Cfap43 G A 19: 47,780,271 T778I possibly damaging Het
Cfap54 A T 10: 93,065,181 N170K probably damaging Het
Cmya5 A T 13: 93,092,643 L1979Q probably damaging Het
Col15a1 A T 4: 47,289,514 E846D probably damaging Het
Col5a1 A G 2: 28,036,888 K308E possibly damaging Het
Dcst1 T A 3: 89,350,424 T680S possibly damaging Het
Dsp T C 13: 38,192,469 L1410P possibly damaging Het
Edem3 T A 1: 151,770,827 probably null Het
Eif4e2 T A 1: 87,220,974 Y64N probably damaging Het
Fcgbp C T 7: 28,085,503 probably benign Het
Gm11639 A T 11: 104,690,934 E34V probably benign Het
Gm7275 A T 16: 48,073,463 noncoding transcript Het
Grin3b G T 10: 79,973,021 V202L probably benign Het
Gsdmc4 G A 15: 63,895,252 S223F possibly damaging Het
Hbp1 T C 12: 31,937,652 H183R probably benign Het
Hectd3 A G 4: 117,002,134 M652V probably benign Het
Hist1h2bm A G 13: 21,722,300 N68S probably benign Het
Hmgxb4 T C 8: 74,999,565 F13L probably benign Het
Hnrnpab T C 11: 51,601,454 K271R probably benign Het
Ilvbl A T 10: 78,577,113 K156N probably benign Het
Iqce A T 5: 140,702,218 probably benign Het
Itpr2 C A 6: 146,329,571 V1194L probably benign Het
Kif18b A G 11: 102,913,544 F384L probably benign Het
Klf14 A G 6: 30,957,839 Y287H probably benign Het
Klhl6 A G 16: 19,957,094 M238T probably benign Het
Lbp G A 2: 158,324,557 V344I probably benign Het
Lrp12 T C 15: 39,876,043 probably null Het
Mapk7 T A 11: 61,493,621 M1L probably benign Het
Muc5b A G 7: 141,861,311 T2665A possibly damaging Het
Ncln A T 10: 81,496,078 probably null Het
Nfxl1 T C 5: 72,540,365 R347G probably benign Het
Npnt C A 3: 132,906,418 C231F probably damaging Het
Nrap T A 19: 56,342,311 H1070L probably benign Het
Nrxn1 G T 17: 90,704,318 Y294* probably null Het
Olfr1261 A G 2: 89,993,438 D15G probably benign Het
Olfr1412 T C 1: 92,588,707 Y126H probably damaging Het
Otog A G 7: 46,298,598 H2341R possibly damaging Het
Paqr3 T C 5: 97,096,028 probably null Het
Pcdhb11 T C 18: 37,423,743 F709L probably benign Het
Phf12 G A 11: 78,027,398 R812Q probably damaging Het
Polr2a A T 11: 69,746,870 L216Q probably damaging Het
Polrmt A G 10: 79,743,497 L140P probably benign Het
Pou2f3 C T 9: 43,134,474 probably null Het
Prkcd A T 14: 30,595,981 N548K probably benign Het
Rpl9 A T 5: 65,388,701 probably benign Het
Rubcnl A T 14: 75,035,472 T211S probably benign Het
Rusc1 C T 3: 89,091,720 G252S probably benign Het
Scnn1g A G 7: 121,738,095 T60A probably damaging Het
Sipa1l2 T G 8: 125,491,684 T305P probably benign Het
Slc18b1 T A 10: 23,824,667 probably benign Het
Sp100 G A 1: 85,681,140 probably null Het
Tekt5 A T 16: 10,387,153 probably null Het
Tlnrd1 T A 7: 83,884,485 probably benign Het
Tpcn1 A G 5: 120,547,397 probably benign Het
Tpcn2 T C 7: 145,260,982 I461V probably benign Het
Traf3ip1 A G 1: 91,527,745 K643E probably damaging Het
Trim33 T C 3: 103,344,576 C914R probably damaging Het
Trip11 G A 12: 101,883,479 T1442I probably damaging Het
Ttll6 A G 11: 96,135,589 M107V possibly damaging Het
Uap1l1 A G 2: 25,363,433 probably benign Het
Ube3b T A 5: 114,415,309 I914N possibly damaging Het
Usp24 A G 4: 106,380,468 T1107A probably damaging Het
Usp40 A T 1: 87,968,400 C811* probably null Het
Vps11 T C 9: 44,359,135 probably null Het
Wdr91 A T 6: 34,891,487 I433N possibly damaging Het
Zfp770 G C 2: 114,196,232 S452* probably null Het
Other mutations in Pygb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Pygb APN 2 150819913 missense probably benign 0.00
IGL01395:Pygb APN 2 150801583 missense probably benign 0.04
IGL01571:Pygb APN 2 150830473 missense probably benign 0.00
IGL01960:Pygb APN 2 150813483 missense probably benign 0.00
IGL03118:Pygb APN 2 150820811 missense probably benign 0.01
R0106:Pygb UTSW 2 150806203 missense probably benign 0.02
R0106:Pygb UTSW 2 150806203 missense probably benign 0.02
R0423:Pygb UTSW 2 150823984 missense probably benign
R0545:Pygb UTSW 2 150815706 missense probably benign 0.00
R0674:Pygb UTSW 2 150815134 splice site probably null
R1052:Pygb UTSW 2 150786938 missense probably benign 0.00
R1590:Pygb UTSW 2 150817663 missense possibly damaging 0.94
R1706:Pygb UTSW 2 150827147 missense probably damaging 1.00
R1786:Pygb UTSW 2 150816772 missense probably damaging 0.98
R2405:Pygb UTSW 2 150820775 missense probably benign 0.04
R3522:Pygb UTSW 2 150828553 missense probably benign 0.07
R4082:Pygb UTSW 2 150826471 critical splice donor site probably null
R4319:Pygb UTSW 2 150815614 splice site probably benign
R4662:Pygb UTSW 2 150815116 missense probably benign
R5072:Pygb UTSW 2 150801578 missense probably damaging 1.00
R5665:Pygb UTSW 2 150820888 splice site probably null
R5874:Pygb UTSW 2 150786878 missense probably benign 0.11
R6610:Pygb UTSW 2 150823966 splice site probably null
R6820:Pygb UTSW 2 150816754 missense possibly damaging 0.88
R7348:Pygb UTSW 2 150786983 missense probably benign 0.10
R7920:Pygb UTSW 2 150787002 missense possibly damaging 0.92
R7936:Pygb UTSW 2 150815669 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CTCCTCAAGAGTGCACTGCTAG -3'
(R):5'- ATCCATCTCTGAGAGCCAGAC -3'

Sequencing Primer
(F):5'- AGGCTGGCTCCTTCAAAC -3'
(R):5'- GTGGCCTCGACACTCTCAAAG -3'
Posted On2017-02-28