Mutagenetix > Incidental Mutation

Incidental Mutation 'R0564:Trio'

46090

Institutional Source

Beutler Lab

Gene Symbol

Trio

Ensembl Gene

ENSMUSG00000022263

Gene Name

triple functional domain (PTPRF interacting)

Synonyms

Solo, 6720464I07Rik

MMRRC Submission

038755-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0564 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27730651-28025848 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27805822 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 527 (N527D)

Ref Sequence

ENSEMBL: ENSMUSP00000154309 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090247] [ENSMUST00000226644] [ENSMUST00000227337]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090247
AA Change: N1671D

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000087714
Gene: ENSMUSG00000022263
AA Change: N1671D

Domain	Start	End	E-Value	Type
low complexity region	2	40	N/A	INTRINSIC
SEC14	68	207	3.4e-26	SMART
SPEC	221	337	2.48e-9	SMART
SPEC	343	445	1.92e-15	SMART
SPEC	569	671	5.35e-14	SMART
SPEC	674	783	1.18e-6	SMART
SPEC	910	1011	2.6e-12	SMART
SPEC	1141	1243	7e-18	SMART
low complexity region	1249	1258	N/A	INTRINSIC
RhoGEF	1296	1466	2.79e-53	SMART
PH	1480	1593	1.53e-9	SMART
SH3	1659	1720	1.9e-8	SMART
low complexity region	1788	1802	N/A	INTRINSIC
low complexity region	1837	1863	N/A	INTRINSIC
low complexity region	1936	1954	N/A	INTRINSIC
RhoGEF	1973	2144	1.32e-63	SMART
PH	2158	2273	3.6e-6	SMART
low complexity region	2291	2341	N/A	INTRINSIC
low complexity region	2371	2390	N/A	INTRINSIC
low complexity region	2491	2503	N/A	INTRINSIC
SH3	2558	2619	1.04e0	SMART
low complexity region	2640	2660	N/A	INTRINSIC
IGc2	2701	2770	4e-12	SMART
S_TKc	2800	3054	4.84e-72	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000226644
AA Change: N527D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000227337
AA Change: N1612D

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)

Meta Mutation Damage Score

0.0968

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that functions as a GDP to GTP exchange factor. This protein promotes the reorganization of the actin cytoskeleton, thereby playing a role in cell migration and growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant mice die during late embryonic development or shortly after birth. They exhibit abnormal skeletal myogenesis and display aberrant organization within the hippocampus and olfactory bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl5	A	G	10: 80,344,847	V127A	probably damaging	Het
Alox12	T	A	11: 70,252,836	D202V	probably damaging	Het
Ankib1	A	G	5: 3,729,655	Y405H	probably damaging	Het
Apbb2	A	T	5: 66,452,250	M18K	probably damaging	Het
Atad2	C	A	15: 58,125,833		probably benign	Het
BC117090	A	T	16: 36,322,984	Y34*	probably null	Het
Birc6	T	A	17: 74,625,243		probably benign	Het
Ccdc126	T	C	6: 49,334,142	M28T	possibly damaging	Het
Cdc16	A	T	8: 13,781,618	D617V	probably damaging	Het
Cep135	G	A	5: 76,615,710	E516K	probably damaging	Het
Cep135	G	T	5: 76,638,949	M1081I	probably benign	Het
Col6a3	A	C	1: 90,807,734	V731G	probably damaging	Het
Cwc27	C	A	13: 104,661,357	E365*	probably null	Het
D230025D16Rik	T	A	8: 105,239,971		probably benign	Het
Dip2b	C	A	15: 100,162,719	Y258*	probably null	Het
Dnah17	A	G	11: 118,082,981	V1900A	probably damaging	Het
Dpysl2	A	T	14: 66,805,446		probably benign	Het
Dync2h1	A	T	9: 7,139,432	L1401Q	probably damaging	Het
Esf1	A	T	2: 140,158,586	Y427N	possibly damaging	Het
Fbln1	T	A	15: 85,227,107	V154D	probably benign	Het
Frem2	A	G	3: 53,656,109	F326L	probably damaging	Het
Gm4922	T	A	10: 18,784,065	N303I	possibly damaging	Het
Hist1h1t	G	T	13: 23,696,324	K153N	possibly damaging	Het
Iigp1	G	A	18: 60,390,451	V214M	probably damaging	Het
Luzp2	A	G	7: 54,835,962	K2E	probably damaging	Het
Mcc	A	G	18: 44,468,507	L410P	probably damaging	Het
Mfn2	A	G	4: 147,883,255	F452S	probably damaging	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Micu2	A	G	14: 57,919,374	F335L	possibly damaging	Het
Mpp3	T	G	11: 102,005,347	K450T	possibly damaging	Het
Mtmr4	T	A	11: 87,598,888	V79E	probably damaging	Het
Nlrp4b	A	G	7: 10,714,658	I263V	probably benign	Het
Olfr551	T	C	7: 102,588,531	I71V	probably benign	Het
Olfr809	T	G	10: 129,776,136	V74G	probably damaging	Het
Pdk1	G	A	2: 71,880,039	W113*	probably null	Het
Phxr4	A	T	9: 13,431,697		probably benign	Het
Rad51ap2	T	A	12: 11,457,896	H606Q	probably benign	Het
Ralgapa1	A	T	12: 55,782,885	I187K	possibly damaging	Het
Rps27	A	G	3: 90,212,923		probably benign	Het
Sema3e	T	A	5: 14,236,085		probably null	Het
Sh2d3c	G	A	2: 32,753,052	C749Y	probably damaging	Het
Siah2	T	C	3: 58,676,235	D210G	probably benign	Het
Smap2	G	A	4: 120,976,977	P155S	probably benign	Het
Snrk	C	T	9: 122,166,544	T463M	possibly damaging	Het
Tm9sf3	A	G	19: 41,245,525		probably benign	Het
Tmem132d	C	T	5: 127,784,778	E760K	probably damaging	Het
Tmem184c	A	T	8: 77,606,160		probably null	Het
Tmem235	A	T	11: 117,860,848	I33F	possibly damaging	Het
Tmem267	A	T	13: 119,492,639		probably null	Het
Top1	G	A	2: 160,714,265	R548Q	probably damaging	Het
Upf3a	A	G	8: 13,795,656	K252E	probably benign	Het

Other mutations in Trio

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Trio	APN	15	27912743	splice site	probably benign
IGL01011:Trio	APN	15	27736489	missense	probably damaging	0.96
IGL01090:Trio	APN	15	27773007	missense	probably damaging	1.00
IGL01145:Trio	APN	15	27818167	splice site	probably benign
IGL01147:Trio	APN	15	27881320	missense	probably damaging	1.00
IGL01161:Trio	APN	15	27749781	missense	probably damaging	1.00
IGL01324:Trio	APN	15	27905323	missense	probably benign	0.42
IGL01352:Trio	APN	15	27901229	missense	probably benign	0.01
IGL01366:Trio	APN	15	27732868	missense	possibly damaging	0.76
IGL01443:Trio	APN	15	27838775	splice site	probably benign
IGL01454:Trio	APN	15	27832985	missense	probably benign	0.32
IGL01695:Trio	APN	15	27773001	missense	probably damaging	1.00
IGL01765:Trio	APN	15	27764026	missense	possibly damaging	0.85
IGL01860:Trio	APN	15	27846810	missense	probably damaging	1.00
IGL01879:Trio	APN	15	27741033	missense	probably benign	0.12
IGL01991:Trio	APN	15	27871274	missense	possibly damaging	0.95
IGL02106:Trio	APN	15	27744158	missense	possibly damaging	0.85
IGL02209:Trio	APN	15	27744053	missense	probably damaging	1.00
IGL02232:Trio	APN	15	27902561	missense	probably benign	0.24
IGL02304:Trio	APN	15	27735436	missense	probably damaging	0.96
IGL02504:Trio	APN	15	27847390	nonsense	probably null
IGL02508:Trio	APN	15	27818104	missense	possibly damaging	0.65
IGL02541:Trio	APN	15	27844930	splice site	probably benign
IGL02617:Trio	APN	15	27841849	splice site	probably benign
IGL02675:Trio	APN	15	27768039	unclassified	probably benign
IGL02817:Trio	APN	15	27902881	missense	probably benign	0.01
IGL02993:Trio	APN	15	27830239	splice site	probably benign
IGL03007:Trio	APN	15	27902742	missense	probably damaging	0.99
IGL03135:Trio	APN	15	27832011	splice site	probably benign
IGL03225:Trio	APN	15	27902695	missense	probably benign	0.30
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0063:Trio	UTSW	15	27881437	splice site	probably benign
R0302:Trio	UTSW	15	27902517	missense	probably damaging	1.00
R0505:Trio	UTSW	15	27767907	missense	probably benign	0.00
R0506:Trio	UTSW	15	27854963	missense	probably benign	0.12
R0659:Trio	UTSW	15	27831399	missense	probably damaging	0.97
R0882:Trio	UTSW	15	27732894	missense	probably damaging	1.00
R0939:Trio	UTSW	15	27741250	critical splice donor site	probably null
R1018:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R1439:Trio	UTSW	15	27897914	missense	probably damaging	1.00
R1456:Trio	UTSW	15	27753804	splice site	probably benign
R1488:Trio	UTSW	15	27740967	missense	probably damaging	1.00
R1522:Trio	UTSW	15	27732640	missense	probably benign	0.28
R1531:Trio	UTSW	15	27832985	missense	probably benign	0.32
R1640:Trio	UTSW	15	27833044	missense	probably damaging	1.00
R1646:Trio	UTSW	15	27758347	missense	possibly damaging	0.91
R1682:Trio	UTSW	15	27744146	splice site	probably null
R1780:Trio	UTSW	15	27744038	missense	possibly damaging	0.93
R1791:Trio	UTSW	15	27841756	missense	probably damaging	1.00
R1803:Trio	UTSW	15	27748340	missense	probably benign
R1817:Trio	UTSW	15	27742495	nonsense	probably null
R1853:Trio	UTSW	15	27756536	missense	probably damaging	1.00
R1898:Trio	UTSW	15	27742380	missense	possibly damaging	0.52
R1937:Trio	UTSW	15	27833056	missense	probably damaging	1.00
R1938:Trio	UTSW	15	27732891	missense	probably damaging	0.98
R2025:Trio	UTSW	15	27744137	missense	probably damaging	0.99
R2025:Trio	UTSW	15	27773927	missense	probably damaging	1.00
R2050:Trio	UTSW	15	27851945	missense	possibly damaging	0.85
R2186:Trio	UTSW	15	27823975	splice site	probably null
R2913:Trio	UTSW	15	27854912	missense	probably damaging	1.00
R3151:Trio	UTSW	15	27805776	missense	probably damaging	1.00
R3771:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3773:Trio	UTSW	15	27748091	missense	probably damaging	0.98
R3826:Trio	UTSW	15	27833070	missense	probably damaging	1.00
R4015:Trio	UTSW	15	27744101	missense	possibly damaging	0.71
R4359:Trio	UTSW	15	27749797	nonsense	probably null
R4370:Trio	UTSW	15	27748337	nonsense	probably null
R4547:Trio	UTSW	15	27818982	missense	possibly damaging	0.89
R4573:Trio	UTSW	15	27772998	small deletion	probably benign
R4620:Trio	UTSW	15	27871171	missense	probably damaging	1.00
R4735:Trio	UTSW	15	27752789	splice site	probably null
R4764:Trio	UTSW	15	27732538	nonsense	probably null
R4775:Trio	UTSW	15	27881342	nonsense	probably null
R4942:Trio	UTSW	15	27752725	missense	probably benign	0.21
R5004:Trio	UTSW	15	27755178	missense	probably damaging	1.00
R5149:Trio	UTSW	15	27754029	missense	possibly damaging	0.74
R5183:Trio	UTSW	15	27902600	missense	probably benign	0.00
R5186:Trio	UTSW	15	27897991	missense	probably damaging	0.97
R5268:Trio	UTSW	15	27748286	missense	probably benign	0.02
R5344:Trio	UTSW	15	27735532	missense	probably benign	0.12
R5407:Trio	UTSW	15	27844806	splice site	probably null
R5442:Trio	UTSW	15	27856194	missense	probably benign	0.04
R5617:Trio	UTSW	15	27902748	missense	probably benign
R5778:Trio	UTSW	15	27856164	missense	probably benign	0.33
R5986:Trio	UTSW	15	27851933	missense	possibly damaging	0.88
R5990:Trio	UTSW	15	27891459	missense	probably benign	0.10
R6011:Trio	UTSW	15	27735545	missense	probably damaging	0.98
R6063:Trio	UTSW	15	27891379	missense	possibly damaging	0.94
R6166:Trio	UTSW	15	27818071	missense	probably damaging	0.96
R6187:Trio	UTSW	15	27743952	critical splice donor site	probably null
R6387:Trio	UTSW	15	27752739	missense	probably damaging	1.00
R6402:Trio	UTSW	15	27902911	missense	probably benign	0.02
R6478:Trio	UTSW	15	27856107	missense	probably benign	0.01
R6528:Trio	UTSW	15	27805870	missense	probably damaging	1.00
R6662:Trio	UTSW	15	27854996	missense	probably benign	0.00
R6825:Trio	UTSW	15	27889308	missense	probably damaging	0.98
R6890:Trio	UTSW	15	27919288	unclassified	probably benign
R6945:Trio	UTSW	15	27824090	missense	probably damaging	1.00
R7027:Trio	UTSW	15	27805654	missense	possibly damaging	0.86
R7046:Trio	UTSW	15	27832051	missense	probably damaging	1.00
R7049:Trio	UTSW	15	27749799	missense	possibly damaging	0.66
R7075:Trio	UTSW	15	27898000	missense	unknown
R7094:Trio	UTSW	15	27891448	missense	unknown
R7123:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7130:Trio	UTSW	15	27742313	critical splice donor site	probably benign
R7214:Trio	UTSW	15	27871187	missense	probably damaging	0.97
R7292:Trio	UTSW	15	27828351	missense	possibly damaging	0.63
R7293:Trio	UTSW	15	27871289	missense	possibly damaging	0.66
R7352:Trio	UTSW	15	27732876	missense	probably damaging	0.96
R7426:Trio	UTSW	15	27856107	missense	probably benign	0.01
R7451:Trio	UTSW	15	27747913	missense	probably benign	0.07
R7558:Trio	UTSW	15	27831394	missense	possibly damaging	0.90
R7578:Trio	UTSW	15	27854939	missense	possibly damaging	0.94
R7596:Trio	UTSW	15	27749826	missense	probably damaging	0.99
R7604:Trio	UTSW	15	27736445	critical splice donor site	probably null
R7609:Trio	UTSW	15	27912642	missense	unknown
R7767:Trio	UTSW	15	27889418	missense	unknown
R7784:Trio	UTSW	15	27763994	missense	probably damaging	1.00
R7817:Trio	UTSW	15	27749866	missense	probably benign	0.35
R7833:Trio	UTSW	15	27774086	missense	probably damaging	0.99
R7873:Trio	UTSW	15	27805684	missense	possibly damaging	0.83
R7879:Trio	UTSW	15	27851924	missense	possibly damaging	0.94
R7989:Trio	UTSW	15	27772935	missense	probably damaging	0.97
R8022:Trio	UTSW	15	27749866	missense	probably benign	0.35
R8050:Trio	UTSW	15	27891454	missense	unknown
R8217:Trio	UTSW	15	27818969	missense	probably damaging	0.97
R8280:Trio	UTSW	15	27902910	missense	unknown
R8283:Trio	UTSW	15	27756542	missense	possibly damaging	0.79
R8300:Trio	UTSW	15	27855022	missense	possibly damaging	0.66
R8321:Trio	UTSW	15	27881326	missense	possibly damaging	0.90
R8477:Trio	UTSW	15	27773952	missense	possibly damaging	0.83
R8479:Trio	UTSW	15	27901200	missense	probably benign	0.25
R8682:Trio	UTSW	15	27905192	missense	unknown
R8688:Trio	UTSW	15	27748238	missense	possibly damaging	0.61
R8708:Trio	UTSW	15	27732546	missense	probably damaging	0.99
R8709:Trio	UTSW	15	27919237	missense	unknown
R8713:Trio	UTSW	15	27743951	critical splice donor site	probably benign
R8798:Trio	UTSW	15	27851837	missense	possibly damaging	0.92
R8812:Trio	UTSW	15	27905225	missense	unknown
R8816:Trio	UTSW	15	27741271	missense	probably damaging	0.96
R8828:Trio	UTSW	15	27741064	missense	possibly damaging	0.93
R8987:Trio	UTSW	15	27732687	missense	probably benign	0.23
R9051:Trio	UTSW	15	27732684	missense	possibly damaging	0.78
R9069:Trio	UTSW	15	27852011	missense	possibly damaging	0.83
R9075:Trio	UTSW	15	27773936	nonsense	probably null
R9079:Trio	UTSW	15	27732937	missense	possibly damaging	0.52
R9139:Trio	UTSW	15	27749836	nonsense	probably null
R9494:Trio	UTSW	15	27846757	missense	probably benign	0.00
R9680:Trio	UTSW	15	27744072	missense	possibly damaging	0.93
R9720:Trio	UTSW	15	27847409	missense	probably benign	0.00
R9726:Trio	UTSW	15	27912666	missense	unknown
X0024:Trio	UTSW	15	27765726	missense	possibly damaging	0.91
Z1176:Trio	UTSW	15	27771387	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACCTTTGTGGTTGAAGATGCCCTC -3'
(R):5'- ATCACGCTGGACTGATGGTGAAC -3'

Sequencing Primer
(F):5'- GGTTGAAGATGCCCTCCATCTC -3'
(R):5'- GGTCAGGACATAGCCTTAGC -3'

Posted On

2013-06-11