Mutagenetix > Incidental Mutation

Incidental Mutation 'R5910:Ube3b'

460913

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

044107-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5910 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 114415309 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 914 (I914N)

Ref Sequence

ENSEMBL: ENSMUSP00000073652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]

AlphaFold

Q9ES34

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074002
AA Change: I914N

PolyPhen 2 Score 0.631 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: I914N

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150630

Predicted Effect

probably benign
Transcript: ENSMUST00000196651

SMART Domains

Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
HECTc	122	495	1.1e-112	SMART

Meta Mutation Damage Score

0.8261

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.0%
20x: 90.5%

Validation Efficiency

95% (93/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	G	6: 121,668,117	N976D	probably damaging	Het
Adamts1	G	A	16: 85,802,149	R188W	probably benign	Het
Adcy4	A	T	14: 55,779,013	V327D	probably damaging	Het
Alg8	T	C	7: 97,390,286	I408T	possibly damaging	Het
Ankib1	T	C	5: 3,693,217	S933G	probably benign	Het
Ap2a2	A	G	7: 141,598,778	D106G	probably damaging	Het
Arhgap22	A	T	14: 33,366,615	H351L	probably damaging	Het
Arhgef2	A	G	3: 88,635,020	Y310C	probably damaging	Het
Atm	A	T	9: 53,448,080	S2804R	probably damaging	Het
Baz2b	A	G	2: 59,977,426	L163P	possibly damaging	Het
Bcl2l12	C	T	7: 44,996,543		probably null	Het
Cdh23	A	G	10: 60,377,821	V1495A	possibly damaging	Het
Cep78	A	G	19: 15,969,128	S447P	possibly damaging	Het
Cfap43	G	A	19: 47,780,271	T778I	possibly damaging	Het
Cfap54	A	T	10: 93,065,181	N170K	probably damaging	Het
Cmya5	A	T	13: 93,092,643	L1979Q	probably damaging	Het
Col15a1	A	T	4: 47,289,514	E846D	probably damaging	Het
Col5a1	A	G	2: 28,036,888	K308E	possibly damaging	Het
Dcst1	T	A	3: 89,350,424	T680S	possibly damaging	Het
Dsp	T	C	13: 38,192,469	L1410P	possibly damaging	Het
Edem3	T	A	1: 151,770,827		probably null	Het
Eif4e2	T	A	1: 87,220,974	Y64N	probably damaging	Het
Fcgbp	C	T	7: 28,085,503		probably benign	Het
Gm11639	A	T	11: 104,690,934	E34V	probably benign	Het
Gm7275	A	T	16: 48,073,463		noncoding transcript	Het
Grin3b	G	T	10: 79,973,021	V202L	probably benign	Het
Gsdmc4	G	A	15: 63,895,252	S223F	possibly damaging	Het
Hbp1	T	C	12: 31,937,652	H183R	probably benign	Het
Hectd3	A	G	4: 117,002,134	M652V	probably benign	Het
Hist1h2bm	A	G	13: 21,722,300	N68S	probably benign	Het
Hmgxb4	T	C	8: 74,999,565	F13L	probably benign	Het
Hnrnpab	T	C	11: 51,601,454	K271R	probably benign	Het
Ilvbl	A	T	10: 78,577,113	K156N	probably benign	Het
Iqce	A	T	5: 140,702,218		probably benign	Het
Itpr2	C	A	6: 146,329,571	V1194L	probably benign	Het
Kif18b	A	G	11: 102,913,544	F384L	probably benign	Het
Klf14	A	G	6: 30,957,839	Y287H	probably benign	Het
Klhl6	A	G	16: 19,957,094	M238T	probably benign	Het
Lbp	G	A	2: 158,324,557	V344I	probably benign	Het
Lrp12	T	C	15: 39,876,043		probably null	Het
Mapk7	T	A	11: 61,493,621	M1L	probably benign	Het
Muc5b	A	G	7: 141,861,311	T2665A	possibly damaging	Het
Ncln	A	T	10: 81,496,078		probably null	Het
Nfxl1	T	C	5: 72,540,365	R347G	probably benign	Het
Npnt	C	A	3: 132,906,418	C231F	probably damaging	Het
Nrap	T	A	19: 56,342,311	H1070L	probably benign	Het
Nrxn1	G	T	17: 90,704,318	Y294*	probably null	Het
Olfr1261	A	G	2: 89,993,438	D15G	probably benign	Het
Olfr1412	T	C	1: 92,588,707	Y126H	probably damaging	Het
Otog	A	G	7: 46,298,598	H2341R	possibly damaging	Het
Paqr3	T	C	5: 97,096,028		probably null	Het
Pcdhb11	T	C	18: 37,423,743	F709L	probably benign	Het
Phf12	G	A	11: 78,027,398	R812Q	probably damaging	Het
Polr2a	A	T	11: 69,746,870	L216Q	probably damaging	Het
Polrmt	A	G	10: 79,743,497	L140P	probably benign	Het
Pou2f3	C	T	9: 43,134,474		probably null	Het
Prkcd	A	T	14: 30,595,981	N548K	probably benign	Het
Pygb	A	G	2: 150,815,700	D361G	probably benign	Het
Rpl9	A	T	5: 65,388,701		probably benign	Het
Rubcnl	A	T	14: 75,035,472	T211S	probably benign	Het
Rusc1	C	T	3: 89,091,720	G252S	probably benign	Het
Scnn1g	A	G	7: 121,738,095	T60A	probably damaging	Het
Sipa1l2	T	G	8: 125,491,684	T305P	probably benign	Het
Slc18b1	T	A	10: 23,824,667		probably benign	Het
Sp100	G	A	1: 85,681,140		probably null	Het
Tekt5	A	T	16: 10,387,153		probably null	Het
Tlnrd1	T	A	7: 83,884,485		probably benign	Het
Tpcn1	A	G	5: 120,547,397		probably benign	Het
Tpcn2	T	C	7: 145,260,982	I461V	probably benign	Het
Traf3ip1	A	G	1: 91,527,745	K643E	probably damaging	Het
Trim33	T	C	3: 103,344,576	C914R	probably damaging	Het
Trip11	G	A	12: 101,883,479	T1442I	probably damaging	Het
Ttll6	A	G	11: 96,135,589	M107V	possibly damaging	Het
Uap1l1	A	G	2: 25,363,433		probably benign	Het
Usp24	A	G	4: 106,380,468	T1107A	probably damaging	Het
Usp40	A	T	1: 87,968,400	C811*	probably null	Het
Vps11	T	C	9: 44,359,135		probably null	Het
Wdr91	A	T	6: 34,891,487	I433N	possibly damaging	Het
Zfp770	G	C	2: 114,196,232	S452*	probably null	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	splice site	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	splice site	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
R7640:Ube3b	UTSW	5	114415323	missense	probably benign
R7825:Ube3b	UTSW	5	114401312	missense	probably damaging	1.00
R7958:Ube3b	UTSW	5	114401423	missense	probably benign	0.05
R8025:Ube3b	UTSW	5	114408209	missense	probably damaging	0.99
R8058:Ube3b	UTSW	5	114406785	missense	possibly damaging	0.58
R8087:Ube3b	UTSW	5	114412489	critical splice donor site	probably null
R8182:Ube3b	UTSW	5	114392138	missense	possibly damaging	0.77
R8322:Ube3b	UTSW	5	114402686	missense	probably benign	0.04
R8465:Ube3b	UTSW	5	114390390	missense	probably damaging	1.00
R8682:Ube3b	UTSW	5	114412290	missense	probably damaging	1.00
R8708:Ube3b	UTSW	5	114393090	missense	probably benign	0.34
R8758:Ube3b	UTSW	5	114415200	critical splice acceptor site	probably benign
R8784:Ube3b	UTSW	5	114388739	missense	probably damaging	1.00
R9058:Ube3b	UTSW	5	114415239	missense	probably benign	0.05
R9072:Ube3b	UTSW	5	114404546	missense	probably damaging	0.98
R9116:Ube3b	UTSW	5	114404776	intron	probably benign
R9537:Ube3b	UTSW	5	114387184	missense	probably damaging	1.00
R9596:Ube3b	UTSW	5	114389110	missense	probably damaging	1.00
R9632:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
R9710:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- GGCTCATCTCTTAGCATGCTTG -3'
(R):5'- TGGGCTGTCATCAGGATACCAG -3'

Sequencing Primer
(F):5'- TCTTAGCATGCTTGGCAGC -3'
(R):5'- GGATACCAGAGTCACTCTATGTCAG -3'

Posted On

2017-02-28