Incidental Mutation 'R5910:Tpcn1'
ID460914
Institutional Source Beutler Lab
Gene Symbol Tpcn1
Ensembl Gene ENSMUSG00000032741
Gene Nametwo pore channel 1
Synonyms5730403B01Rik
MMRRC Submission 044107-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5910 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120534153-120588673 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 120547397 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046426]
Predicted Effect probably benign
Transcript: ENSMUST00000046426
SMART Domains Protein: ENSMUSP00000042188
Gene: ENSMUSG00000032741

DomainStartEndE-ValueType
Pfam:Ion_trans 106 332 1.5e-30 PFAM
Pfam:Ion_trans 441 695 1.2e-31 PFAM
SCOP:d1fxkc_ 713 795 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201971
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 95% (93/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated Ca(2+) and Na+ channels have 4 homologous domains, each containing 6 transmembrane segments, S1 to S6. TPCN1 is similar to these channels, but it has only 2 domains containing S1 to S6 (Ishibashi et al., 2000 [PubMed 10753632]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous inactivation of this gene results in no apparent phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,668,117 N976D probably damaging Het
Adamts1 G A 16: 85,802,149 R188W probably benign Het
Adcy4 A T 14: 55,779,013 V327D probably damaging Het
Alg8 T C 7: 97,390,286 I408T possibly damaging Het
Ankib1 T C 5: 3,693,217 S933G probably benign Het
Ap2a2 A G 7: 141,598,778 D106G probably damaging Het
Arhgap22 A T 14: 33,366,615 H351L probably damaging Het
Arhgef2 A G 3: 88,635,020 Y310C probably damaging Het
Atm A T 9: 53,448,080 S2804R probably damaging Het
Baz2b A G 2: 59,977,426 L163P possibly damaging Het
Bcl2l12 C T 7: 44,996,543 probably null Het
Cdh23 A G 10: 60,377,821 V1495A possibly damaging Het
Cep78 A G 19: 15,969,128 S447P possibly damaging Het
Cfap43 G A 19: 47,780,271 T778I possibly damaging Het
Cfap54 A T 10: 93,065,181 N170K probably damaging Het
Cmya5 A T 13: 93,092,643 L1979Q probably damaging Het
Col15a1 A T 4: 47,289,514 E846D probably damaging Het
Col5a1 A G 2: 28,036,888 K308E possibly damaging Het
Dcst1 T A 3: 89,350,424 T680S possibly damaging Het
Dsp T C 13: 38,192,469 L1410P possibly damaging Het
Edem3 T A 1: 151,770,827 probably null Het
Eif4e2 T A 1: 87,220,974 Y64N probably damaging Het
Fcgbp C T 7: 28,085,503 probably benign Het
Gm11639 A T 11: 104,690,934 E34V probably benign Het
Gm7275 A T 16: 48,073,463 noncoding transcript Het
Grin3b G T 10: 79,973,021 V202L probably benign Het
Gsdmc4 G A 15: 63,895,252 S223F possibly damaging Het
Hbp1 T C 12: 31,937,652 H183R probably benign Het
Hectd3 A G 4: 117,002,134 M652V probably benign Het
Hist1h2bm A G 13: 21,722,300 N68S probably benign Het
Hmgxb4 T C 8: 74,999,565 F13L probably benign Het
Hnrnpab T C 11: 51,601,454 K271R probably benign Het
Ilvbl A T 10: 78,577,113 K156N probably benign Het
Iqce A T 5: 140,702,218 probably benign Het
Itpr2 C A 6: 146,329,571 V1194L probably benign Het
Kif18b A G 11: 102,913,544 F384L probably benign Het
Klf14 A G 6: 30,957,839 Y287H probably benign Het
Klhl6 A G 16: 19,957,094 M238T probably benign Het
Lbp G A 2: 158,324,557 V344I probably benign Het
Lrp12 T C 15: 39,876,043 probably null Het
Mapk7 T A 11: 61,493,621 M1L probably benign Het
Muc5b A G 7: 141,861,311 T2665A possibly damaging Het
Ncln A T 10: 81,496,078 probably null Het
Nfxl1 T C 5: 72,540,365 R347G probably benign Het
Npnt C A 3: 132,906,418 C231F probably damaging Het
Nrap T A 19: 56,342,311 H1070L probably benign Het
Nrxn1 G T 17: 90,704,318 Y294* probably null Het
Olfr1261 A G 2: 89,993,438 D15G probably benign Het
Olfr1412 T C 1: 92,588,707 Y126H probably damaging Het
Otog A G 7: 46,298,598 H2341R possibly damaging Het
Paqr3 T C 5: 97,096,028 probably null Het
Pcdhb11 T C 18: 37,423,743 F709L probably benign Het
Phf12 G A 11: 78,027,398 R812Q probably damaging Het
Polr2a A T 11: 69,746,870 L216Q probably damaging Het
Polrmt A G 10: 79,743,497 L140P probably benign Het
Pou2f3 C T 9: 43,134,474 probably null Het
Prkcd A T 14: 30,595,981 N548K probably benign Het
Pygb A G 2: 150,815,700 D361G probably benign Het
Rpl9 A T 5: 65,388,701 probably benign Het
Rubcnl A T 14: 75,035,472 T211S probably benign Het
Rusc1 C T 3: 89,091,720 G252S probably benign Het
Scnn1g A G 7: 121,738,095 T60A probably damaging Het
Sipa1l2 T G 8: 125,491,684 T305P probably benign Het
Slc18b1 T A 10: 23,824,667 probably benign Het
Sp100 G A 1: 85,681,140 probably null Het
Tekt5 A T 16: 10,387,153 probably null Het
Tlnrd1 T A 7: 83,884,485 probably benign Het
Tpcn2 T C 7: 145,260,982 I461V probably benign Het
Traf3ip1 A G 1: 91,527,745 K643E probably damaging Het
Trim33 T C 3: 103,344,576 C914R probably damaging Het
Trip11 G A 12: 101,883,479 T1442I probably damaging Het
Ttll6 A G 11: 96,135,589 M107V possibly damaging Het
Uap1l1 A G 2: 25,363,433 probably benign Het
Ube3b T A 5: 114,415,309 I914N possibly damaging Het
Usp24 A G 4: 106,380,468 T1107A probably damaging Het
Usp40 A T 1: 87,968,400 C811* probably null Het
Vps11 T C 9: 44,359,135 probably null Het
Wdr91 A T 6: 34,891,487 I433N possibly damaging Het
Zfp770 G C 2: 114,196,232 S452* probably null Het
Other mutations in Tpcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Tpcn1 APN 5 120545305 missense probably damaging 0.99
IGL00551:Tpcn1 APN 5 120560325 missense probably benign 0.31
IGL02197:Tpcn1 APN 5 120553531 missense probably damaging 1.00
IGL02584:Tpcn1 APN 5 120539032 missense probably damaging 0.99
IGL03064:Tpcn1 APN 5 120537566 missense possibly damaging 0.90
PIT1430001:Tpcn1 UTSW 5 120548323 splice site probably benign
R0295:Tpcn1 UTSW 5 120539060 missense probably damaging 1.00
R0316:Tpcn1 UTSW 5 120539259 missense probably damaging 1.00
R1577:Tpcn1 UTSW 5 120544420 missense probably damaging 1.00
R1660:Tpcn1 UTSW 5 120549515 missense possibly damaging 0.82
R1819:Tpcn1 UTSW 5 120536227 splice site probably null
R2051:Tpcn1 UTSW 5 120543388 missense probably damaging 1.00
R2364:Tpcn1 UTSW 5 120553494 nonsense probably null
R2497:Tpcn1 UTSW 5 120538998 splice site probably null
R3965:Tpcn1 UTSW 5 120556575 missense probably damaging 0.98
R3972:Tpcn1 UTSW 5 120553752 critical splice donor site probably null
R4062:Tpcn1 UTSW 5 120557897 missense possibly damaging 0.82
R4343:Tpcn1 UTSW 5 120560220 missense probably damaging 1.00
R4422:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4423:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4424:Tpcn1 UTSW 5 120542518 missense probably damaging 1.00
R4655:Tpcn1 UTSW 5 120539257 missense probably damaging 0.98
R4831:Tpcn1 UTSW 5 120553489 missense probably damaging 1.00
R4910:Tpcn1 UTSW 5 120556519 missense probably damaging 0.98
R4948:Tpcn1 UTSW 5 120556531 missense probably benign 0.15
R4965:Tpcn1 UTSW 5 120547487 missense possibly damaging 0.82
R4976:Tpcn1 UTSW 5 120560322 missense probably benign
R5071:Tpcn1 UTSW 5 120548269 critical splice donor site probably null
R5165:Tpcn1 UTSW 5 120557945 missense probably damaging 1.00
R5210:Tpcn1 UTSW 5 120539214 missense probably damaging 1.00
R5939:Tpcn1 UTSW 5 120539827 missense probably damaging 1.00
R6364:Tpcn1 UTSW 5 120553810 missense probably damaging 1.00
R6633:Tpcn1 UTSW 5 120544464 missense probably benign 0.03
R6650:Tpcn1 UTSW 5 120537562 missense probably null 0.50
R6885:Tpcn1 UTSW 5 120544437 missense probably benign 0.21
R7038:Tpcn1 UTSW 5 120585277 missense probably damaging 0.99
R7247:Tpcn1 UTSW 5 120585250 missense possibly damaging 0.63
R7594:Tpcn1 UTSW 5 120556530 missense possibly damaging 0.67
R7629:Tpcn1 UTSW 5 120537937 missense probably benign 0.00
R7854:Tpcn1 UTSW 5 120549588 missense probably damaging 1.00
R8478:Tpcn1 UTSW 5 120560321 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAAGCAACCACACGTGATC -3'
(R):5'- AGTCACTTTTCAGTCAAGGGCTAG -3'

Sequencing Primer
(F):5'- ACACGTGATCACTTCTGCAC -3'
(R):5'- AGACAGGGTTTCTCTGCATAGCC -3'
Posted On2017-02-28