Mutagenetix > Incidental Mutation

Incidental Mutation 'R5910:Scnn1g'

460924

Institutional Source

Beutler Lab

Gene Symbol

Scnn1g

Ensembl Gene

ENSMUSG00000000216

Gene Name

sodium channel, nonvoltage-gated 1 gamma

Synonyms

ENaC gamma

MMRRC Submission

044107-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.667) question?

Stock #

R5910 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121734479-121768475 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 121738095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 60 (T60A)

Ref Sequence

ENSEMBL: ENSMUSP00000000221 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000221]

AlphaFold

Q9WU39

Predicted Effect

probably damaging
Transcript: ENSMUST00000000221
AA Change: T60A

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000000221
Gene: ENSMUSG00000000216
AA Change: T60A

Domain	Start	End	E-Value	Type
Pfam:ASC	32	558	6.4e-91	PFAM
low complexity region	618	631	N/A	INTRINSIC

Meta Mutation Damage Score

0.5708

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 97.0%
20x: 90.5%

Validation Efficiency

95% (93/98)

MGI Phenotype

FUNCTION: This gene encodes the gamma subunit of the epithelial sodium channel, a member of the amiloride-sensitive sodium channel family of proteins. This channel regulates sodium homeostasis and blood pressure, by controlling sodium transport in the kidney, colon and lung. Proteolytic processing of the encoded protein results in the release of an inhibitory peptide and channel activation. Homozygous knockout mice for this gene exhibit perinatal lethality, likely due to excess serum potassium. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality between 24-36 hours after birth. Newborns exhibit hyperkalemia, clear lung liquid more slowly, and show low urinary potassium and high urinary sodium concentrations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	G	6: 121,668,117	N976D	probably damaging	Het
Adamts1	G	A	16: 85,802,149	R188W	probably benign	Het
Adcy4	A	T	14: 55,779,013	V327D	probably damaging	Het
Alg8	T	C	7: 97,390,286	I408T	possibly damaging	Het
Ankib1	T	C	5: 3,693,217	S933G	probably benign	Het
Ap2a2	A	G	7: 141,598,778	D106G	probably damaging	Het
Arhgap22	A	T	14: 33,366,615	H351L	probably damaging	Het
Arhgef2	A	G	3: 88,635,020	Y310C	probably damaging	Het
Atm	A	T	9: 53,448,080	S2804R	probably damaging	Het
Baz2b	A	G	2: 59,977,426	L163P	possibly damaging	Het
Bcl2l12	C	T	7: 44,996,543		probably null	Het
Cdh23	A	G	10: 60,377,821	V1495A	possibly damaging	Het
Cep78	A	G	19: 15,969,128	S447P	possibly damaging	Het
Cfap43	G	A	19: 47,780,271	T778I	possibly damaging	Het
Cfap54	A	T	10: 93,065,181	N170K	probably damaging	Het
Cmya5	A	T	13: 93,092,643	L1979Q	probably damaging	Het
Col15a1	A	T	4: 47,289,514	E846D	probably damaging	Het
Col5a1	A	G	2: 28,036,888	K308E	possibly damaging	Het
Dcst1	T	A	3: 89,350,424	T680S	possibly damaging	Het
Dsp	T	C	13: 38,192,469	L1410P	possibly damaging	Het
Edem3	T	A	1: 151,770,827		probably null	Het
Eif4e2	T	A	1: 87,220,974	Y64N	probably damaging	Het
Fcgbp	C	T	7: 28,085,503		probably benign	Het
Gm11639	A	T	11: 104,690,934	E34V	probably benign	Het
Gm7275	A	T	16: 48,073,463		noncoding transcript	Het
Grin3b	G	T	10: 79,973,021	V202L	probably benign	Het
Gsdmc4	G	A	15: 63,895,252	S223F	possibly damaging	Het
Hbp1	T	C	12: 31,937,652	H183R	probably benign	Het
Hectd3	A	G	4: 117,002,134	M652V	probably benign	Het
Hist1h2bm	A	G	13: 21,722,300	N68S	probably benign	Het
Hmgxb4	T	C	8: 74,999,565	F13L	probably benign	Het
Hnrnpab	T	C	11: 51,601,454	K271R	probably benign	Het
Ilvbl	A	T	10: 78,577,113	K156N	probably benign	Het
Iqce	A	T	5: 140,702,218		probably benign	Het
Itpr2	C	A	6: 146,329,571	V1194L	probably benign	Het
Kif18b	A	G	11: 102,913,544	F384L	probably benign	Het
Klf14	A	G	6: 30,957,839	Y287H	probably benign	Het
Klhl6	A	G	16: 19,957,094	M238T	probably benign	Het
Lbp	G	A	2: 158,324,557	V344I	probably benign	Het
Lrp12	T	C	15: 39,876,043		probably null	Het
Mapk7	T	A	11: 61,493,621	M1L	probably benign	Het
Muc5b	A	G	7: 141,861,311	T2665A	possibly damaging	Het
Ncln	A	T	10: 81,496,078		probably null	Het
Nfxl1	T	C	5: 72,540,365	R347G	probably benign	Het
Npnt	C	A	3: 132,906,418	C231F	probably damaging	Het
Nrap	T	A	19: 56,342,311	H1070L	probably benign	Het
Nrxn1	G	T	17: 90,704,318	Y294*	probably null	Het
Olfr1261	A	G	2: 89,993,438	D15G	probably benign	Het
Olfr1412	T	C	1: 92,588,707	Y126H	probably damaging	Het
Otog	A	G	7: 46,298,598	H2341R	possibly damaging	Het
Paqr3	T	C	5: 97,096,028		probably null	Het
Pcdhb11	T	C	18: 37,423,743	F709L	probably benign	Het
Phf12	G	A	11: 78,027,398	R812Q	probably damaging	Het
Polr2a	A	T	11: 69,746,870	L216Q	probably damaging	Het
Polrmt	A	G	10: 79,743,497	L140P	probably benign	Het
Pou2f3	C	T	9: 43,134,474		probably null	Het
Prkcd	A	T	14: 30,595,981	N548K	probably benign	Het
Pygb	A	G	2: 150,815,700	D361G	probably benign	Het
Rpl9	A	T	5: 65,388,701		probably benign	Het
Rubcnl	A	T	14: 75,035,472	T211S	probably benign	Het
Rusc1	C	T	3: 89,091,720	G252S	probably benign	Het
Sipa1l2	T	G	8: 125,491,684	T305P	probably benign	Het
Slc18b1	T	A	10: 23,824,667		probably benign	Het
Sp100	G	A	1: 85,681,140		probably null	Het
Tekt5	A	T	16: 10,387,153		probably null	Het
Tlnrd1	T	A	7: 83,884,485		probably benign	Het
Tpcn1	A	G	5: 120,547,397		probably benign	Het
Tpcn2	T	C	7: 145,260,982	I461V	probably benign	Het
Traf3ip1	A	G	1: 91,527,745	K643E	probably damaging	Het
Trim33	T	C	3: 103,344,576	C914R	probably damaging	Het
Trip11	G	A	12: 101,883,479	T1442I	probably damaging	Het
Ttll6	A	G	11: 96,135,589	M107V	possibly damaging	Het
Uap1l1	A	G	2: 25,363,433		probably benign	Het
Ube3b	T	A	5: 114,415,309	I914N	possibly damaging	Het
Usp24	A	G	4: 106,380,468	T1107A	probably damaging	Het
Usp40	A	T	1: 87,968,400	C811*	probably null	Het
Vps11	T	C	9: 44,359,135		probably null	Het
Wdr91	A	T	6: 34,891,487	I433N	possibly damaging	Het
Zfp770	G	C	2: 114,196,232	S452*	probably null	Het

Other mutations in Scnn1g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00819:Scnn1g	APN	7	121740437	missense	probably benign	0.00
IGL01824:Scnn1g	APN	7	121766293	missense	probably benign	0.00
IGL02133:Scnn1g	APN	7	121743699	missense	probably damaging	1.00
IGL02529:Scnn1g	APN	7	121742446	splice site	probably benign
IGL02814:Scnn1g	APN	7	121740365	missense	probably damaging	1.00
IGL03091:Scnn1g	APN	7	121746683	missense	probably damaging	1.00
IGL03253:Scnn1g	APN	7	121737933	nonsense	probably null
PIT4504001:Scnn1g	UTSW	7	121742331	missense	probably benign	0.30
R0230:Scnn1g	UTSW	7	121746761	splice site	probably benign
R0324:Scnn1g	UTSW	7	121740555	missense	possibly damaging	0.62
R0367:Scnn1g	UTSW	7	121746579	splice site	probably benign
R0534:Scnn1g	UTSW	7	121767424	missense	probably benign	0.00
R1747:Scnn1g	UTSW	7	121760463	missense	probably damaging	0.99
R2004:Scnn1g	UTSW	7	121738188	nonsense	probably null
R2197:Scnn1g	UTSW	7	121767296	missense	probably damaging	1.00
R4396:Scnn1g	UTSW	7	121740427	missense	probably benign	0.01
R4804:Scnn1g	UTSW	7	121763080	frame shift	probably null
R4805:Scnn1g	UTSW	7	121746602	missense	probably damaging	1.00
R5219:Scnn1g	UTSW	7	121766266	missense	probably damaging	1.00
R5757:Scnn1g	UTSW	7	121738215	missense	probably damaging	1.00
R5882:Scnn1g	UTSW	7	121767358	missense	possibly damaging	0.79
R6381:Scnn1g	UTSW	7	121767499	missense	probably benign	0.00
R6666:Scnn1g	UTSW	7	121767388	missense	probably benign	0.00
R6735:Scnn1g	UTSW	7	121742263	missense	probably benign	0.02
R6813:Scnn1g	UTSW	7	121740353	missense	probably damaging	1.00
R6860:Scnn1g	UTSW	7	121740353	missense	probably damaging	1.00
R6887:Scnn1g	UTSW	7	121760444	missense	probably benign	0.01
R7289:Scnn1g	UTSW	7	121738081	nonsense	probably null
R7488:Scnn1g	UTSW	7	121763434	missense	probably benign	0.00
R7630:Scnn1g	UTSW	7	121760481	missense	probably damaging	1.00
R7888:Scnn1g	UTSW	7	121743655	missense	probably damaging	0.97
R7917:Scnn1g	UTSW	7	121743693	missense	probably damaging	1.00
R9051:Scnn1g	UTSW	7	121742343	missense	possibly damaging	0.86
R9312:Scnn1g	UTSW	7	121740595	missense	probably benign	0.00
Z1177:Scnn1g	UTSW	7	121760475	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TTCAGAACTCTGCAGGCTGC -3'
(R):5'- ATAAGAGGCCAGACTTCCCTCTC -3'

Sequencing Primer
(F):5'- AGGCTGCAAAGTCCTGTC -3'
(R):5'- TCTCTCAGATGCCAGGGTG -3'

Posted On

2017-02-28