Incidental Mutation 'R5910:Sipa1l2'
ID460929
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Namesignal-induced proliferation-associated 1 like 2
Synonyms
MMRRC Submission 044107-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R5910 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location125418063-125569808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 125491684 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 305 (T305P)
Ref Sequence ENSEMBL: ENSMUSP00000148557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
Predicted Effect probably benign
Transcript: ENSMUST00000108775
AA Change: T305P

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: T305P

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212168
AA Change: T305P

PolyPhen 2 Score 0.417 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000212987
AA Change: T305P

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
Meta Mutation Damage Score 0.0598 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 95% (93/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,668,117 N976D probably damaging Het
Adamts1 G A 16: 85,802,149 R188W probably benign Het
Adcy4 A T 14: 55,779,013 V327D probably damaging Het
Alg8 T C 7: 97,390,286 I408T possibly damaging Het
Ankib1 T C 5: 3,693,217 S933G probably benign Het
Ap2a2 A G 7: 141,598,778 D106G probably damaging Het
Arhgap22 A T 14: 33,366,615 H351L probably damaging Het
Arhgef2 A G 3: 88,635,020 Y310C probably damaging Het
Atm A T 9: 53,448,080 S2804R probably damaging Het
Baz2b A G 2: 59,977,426 L163P possibly damaging Het
Bcl2l12 C T 7: 44,996,543 probably null Het
Cdh23 A G 10: 60,377,821 V1495A possibly damaging Het
Cep78 A G 19: 15,969,128 S447P possibly damaging Het
Cfap43 G A 19: 47,780,271 T778I possibly damaging Het
Cfap54 A T 10: 93,065,181 N170K probably damaging Het
Cmya5 A T 13: 93,092,643 L1979Q probably damaging Het
Col15a1 A T 4: 47,289,514 E846D probably damaging Het
Col5a1 A G 2: 28,036,888 K308E possibly damaging Het
Dcst1 T A 3: 89,350,424 T680S possibly damaging Het
Dsp T C 13: 38,192,469 L1410P possibly damaging Het
Edem3 T A 1: 151,770,827 probably null Het
Eif4e2 T A 1: 87,220,974 Y64N probably damaging Het
Fcgbp C T 7: 28,085,503 probably benign Het
Gm11639 A T 11: 104,690,934 E34V probably benign Het
Gm7275 A T 16: 48,073,463 noncoding transcript Het
Grin3b G T 10: 79,973,021 V202L probably benign Het
Gsdmc4 G A 15: 63,895,252 S223F possibly damaging Het
Hbp1 T C 12: 31,937,652 H183R probably benign Het
Hectd3 A G 4: 117,002,134 M652V probably benign Het
Hist1h2bm A G 13: 21,722,300 N68S probably benign Het
Hmgxb4 T C 8: 74,999,565 F13L probably benign Het
Hnrnpab T C 11: 51,601,454 K271R probably benign Het
Ilvbl A T 10: 78,577,113 K156N probably benign Het
Iqce A T 5: 140,702,218 probably benign Het
Itpr2 C A 6: 146,329,571 V1194L probably benign Het
Kif18b A G 11: 102,913,544 F384L probably benign Het
Klf14 A G 6: 30,957,839 Y287H probably benign Het
Klhl6 A G 16: 19,957,094 M238T probably benign Het
Lbp G A 2: 158,324,557 V344I probably benign Het
Lrp12 T C 15: 39,876,043 probably null Het
Mapk7 T A 11: 61,493,621 M1L probably benign Het
Muc5b A G 7: 141,861,311 T2665A possibly damaging Het
Ncln A T 10: 81,496,078 probably null Het
Nfxl1 T C 5: 72,540,365 R347G probably benign Het
Npnt C A 3: 132,906,418 C231F probably damaging Het
Nrap T A 19: 56,342,311 H1070L probably benign Het
Nrxn1 G T 17: 90,704,318 Y294* probably null Het
Olfr1261 A G 2: 89,993,438 D15G probably benign Het
Olfr1412 T C 1: 92,588,707 Y126H probably damaging Het
Otog A G 7: 46,298,598 H2341R possibly damaging Het
Paqr3 T C 5: 97,096,028 probably null Het
Pcdhb11 T C 18: 37,423,743 F709L probably benign Het
Phf12 G A 11: 78,027,398 R812Q probably damaging Het
Polr2a A T 11: 69,746,870 L216Q probably damaging Het
Polrmt A G 10: 79,743,497 L140P probably benign Het
Pou2f3 C T 9: 43,134,474 probably null Het
Prkcd A T 14: 30,595,981 N548K probably benign Het
Pygb A G 2: 150,815,700 D361G probably benign Het
Rpl9 A T 5: 65,388,701 probably benign Het
Rubcnl A T 14: 75,035,472 T211S probably benign Het
Rusc1 C T 3: 89,091,720 G252S probably benign Het
Scnn1g A G 7: 121,738,095 T60A probably damaging Het
Slc18b1 T A 10: 23,824,667 probably benign Het
Sp100 G A 1: 85,681,140 probably null Het
Tekt5 A T 16: 10,387,153 probably null Het
Tlnrd1 T A 7: 83,884,485 probably benign Het
Tpcn1 A G 5: 120,547,397 probably benign Het
Tpcn2 T C 7: 145,260,982 I461V probably benign Het
Traf3ip1 A G 1: 91,527,745 K643E probably damaging Het
Trim33 T C 3: 103,344,576 C914R probably damaging Het
Trip11 G A 12: 101,883,479 T1442I probably damaging Het
Ttll6 A G 11: 96,135,589 M107V possibly damaging Het
Uap1l1 A G 2: 25,363,433 probably benign Het
Ube3b T A 5: 114,415,309 I914N possibly damaging Het
Usp24 A G 4: 106,380,468 T1107A probably damaging Het
Usp40 A T 1: 87,968,400 C811* probably null Het
Vps11 T C 9: 44,359,135 probably null Het
Wdr91 A T 6: 34,891,487 I433N possibly damaging Het
Zfp770 G C 2: 114,196,232 S452* probably null Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 125491806 missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 125464435 splice site probably benign
IGL00965:Sipa1l2 APN 8 125447874 missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 125491518 missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 125422577 critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 125453292 splice site probably benign
IGL01930:Sipa1l2 APN 8 125419239 missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 125491819 missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 125447837 missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 125492011 missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 125480269 missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 125451977 missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 125447768 missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 125491659 missense possibly damaging 0.67
Rebellious UTSW 8 125468339 missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 125449876 splice site probably null
R0153:Sipa1l2 UTSW 8 125421898 missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 125421940 missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 125447697 missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 125464410 missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 125480332 missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 125422624 nonsense probably null
R1377:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 125468725 missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 125447613 missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 125492262 missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 125491617 missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 125421895 missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 125444535 missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 125480141 splice site probably null
R1940:Sipa1l2 UTSW 8 125480148 splice site probably benign
R2007:Sipa1l2 UTSW 8 125439437 missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 125491491 missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 125491627 missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 125492374 missense probably damaging 0.99
R3722:Sipa1l2 UTSW 8 125473584 missense probably damaging 1.00
R3787:Sipa1l2 UTSW 8 125423205 missense probably benign
R3787:Sipa1l2 UTSW 8 125450383 missense possibly damaging 0.52
R4106:Sipa1l2 UTSW 8 125492308 missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 125468510 missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 125491672 missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 125492355 missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 125492424 missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 125464415 missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 125453470 missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 125491245 missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 125473601 missense probably damaging 1.00
R4890:Sipa1l2 UTSW 8 125491867 missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 125491585 missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 125439273 missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 125492126 missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 125491248 missense probably damaging 1.00
R5916:Sipa1l2 UTSW 8 125468573 missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 125473536 missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 125468473 missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 125468253 nonsense probably null
R6235:Sipa1l2 UTSW 8 125474871 missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 125469872 missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 125453464 missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 125444630 missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 125444484 critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 125491230 missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 125449894 missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 125450362 missense possibly damaging 0.50
R7154:Sipa1l2 UTSW 8 125468339 missense probably benign 0.01
R7192:Sipa1l2 UTSW 8 125422609 missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 125469860 missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 125453332 missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 125447646 missense probably damaging 1.00
R7417:Sipa1l2 UTSW 8 125482106 missense possibly damaging 0.93
R7604:Sipa1l2 UTSW 8 125419272 missense probably benign 0.45
R7658:Sipa1l2 UTSW 8 125492290 missense probably benign 0.00
R7743:Sipa1l2 UTSW 8 125464233 missense probably damaging 1.00
R7781:Sipa1l2 UTSW 8 125491827 missense possibly damaging 0.46
R7812:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R7829:Sipa1l2 UTSW 8 125451988 missense probably damaging 1.00
R7880:Sipa1l2 UTSW 8 125464393 missense probably damaging 1.00
R7884:Sipa1l2 UTSW 8 125447598 missense probably benign
R8057:Sipa1l2 UTSW 8 125468530 missense probably damaging 1.00
R8082:Sipa1l2 UTSW 8 125491809 missense possibly damaging 0.82
R8092:Sipa1l2 UTSW 8 125419168 missense probably benign 0.03
R8247:Sipa1l2 UTSW 8 125422633 missense probably benign 0.29
R8252:Sipa1l2 UTSW 8 125468671 missense probably damaging 1.00
R8386:Sipa1l2 UTSW 8 125492093 missense probably damaging 1.00
X0027:Sipa1l2 UTSW 8 125492136 missense probably damaging 1.00
Z1177:Sipa1l2 UTSW 8 125447556 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- GTTGAGGTCCTCCTTACTGC -3'
(R):5'- AGCAGCCCAGATTTCCAGAG -3'

Sequencing Primer
(F):5'- TACAGGAACCGGGGTCTGTG -3'
(R):5'- CAGAGGAGAATTTGTCCGCATCTC -3'
Posted On2017-02-28