Incidental Mutation 'R0564:Dip2b'
ID 46093
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 038755-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R0564 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 100060600 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 258 (Y258*)
Ref Sequence ENSEMBL: ENSMUSP00000104599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
AlphaFold Q3UH60
Predicted Effect probably null
Transcript: ENSMUST00000023768
AA Change: Y258*
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: Y258*

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000100203
AA Change: Y492*
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: Y492*

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000108971
AA Change: Y258*
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: Y258*

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230733
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,180,681 (GRCm39) V127A probably damaging Het
Alox12 T A 11: 70,143,662 (GRCm39) D202V probably damaging Het
Ankib1 A G 5: 3,779,655 (GRCm39) Y405H probably damaging Het
Apbb2 A T 5: 66,609,593 (GRCm39) M18K probably damaging Het
Atad2 C A 15: 57,989,229 (GRCm39) probably benign Het
Birc6 T A 17: 74,932,238 (GRCm39) probably benign Het
Ccdc126 T C 6: 49,311,076 (GRCm39) M28T possibly damaging Het
Cdc16 A T 8: 13,831,618 (GRCm39) D617V probably damaging Het
Cep135 G A 5: 76,763,557 (GRCm39) E516K probably damaging Het
Cep135 G T 5: 76,786,796 (GRCm39) M1081I probably benign Het
Col6a3 A C 1: 90,735,456 (GRCm39) V731G probably damaging Het
Cstdc6 A T 16: 36,143,346 (GRCm39) Y34* probably null Het
Cwc27 C A 13: 104,797,865 (GRCm39) E365* probably null Het
Dnah17 A G 11: 117,973,807 (GRCm39) V1900A probably damaging Het
Dpysl2 A T 14: 67,042,895 (GRCm39) probably benign Het
Dync2h1 A T 9: 7,139,432 (GRCm39) L1401Q probably damaging Het
Esf1 A T 2: 140,000,506 (GRCm39) Y427N possibly damaging Het
Fbln1 T A 15: 85,111,308 (GRCm39) V154D probably benign Het
Frem2 A G 3: 53,563,530 (GRCm39) F326L probably damaging Het
Gm4922 T A 10: 18,659,813 (GRCm39) N303I possibly damaging Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Iigp1 G A 18: 60,523,523 (GRCm39) V214M probably damaging Het
Luzp2 A G 7: 54,485,710 (GRCm39) K2E probably damaging Het
Mcc A G 18: 44,601,574 (GRCm39) L410P probably damaging Het
Mfn2 A G 4: 147,967,712 (GRCm39) F452S probably damaging Het
Mib2 C T 4: 155,743,917 (GRCm39) G42S probably damaging Het
Micu2 A G 14: 58,156,831 (GRCm39) F335L possibly damaging Het
Mpp3 T G 11: 101,896,173 (GRCm39) K450T possibly damaging Het
Mtmr4 T A 11: 87,489,714 (GRCm39) V79E probably damaging Het
Nlrp4b A G 7: 10,448,585 (GRCm39) I263V probably benign Het
Or52p2 T C 7: 102,237,738 (GRCm39) I71V probably benign Het
Or6c76 T G 10: 129,612,005 (GRCm39) V74G probably damaging Het
Pdk1 G A 2: 71,710,383 (GRCm39) W113* probably null Het
Phaf1 T A 8: 105,966,603 (GRCm39) probably benign Het
Phxr4 A T 9: 13,342,993 (GRCm39) probably benign Het
Rad51ap2 T A 12: 11,507,897 (GRCm39) H606Q probably benign Het
Ralgapa1 A T 12: 55,829,670 (GRCm39) I187K possibly damaging Het
Rps27 A G 3: 90,120,230 (GRCm39) probably benign Het
Sema3e T A 5: 14,286,099 (GRCm39) probably null Het
Sh2d3c G A 2: 32,643,064 (GRCm39) C749Y probably damaging Het
Siah2 T C 3: 58,583,656 (GRCm39) D210G probably benign Het
Smap2 G A 4: 120,834,174 (GRCm39) P155S probably benign Het
Snrk C T 9: 121,995,610 (GRCm39) T463M possibly damaging Het
Tm9sf3 A G 19: 41,233,964 (GRCm39) probably benign Het
Tmem132d C T 5: 127,861,842 (GRCm39) E760K probably damaging Het
Tmem184c A T 8: 78,332,789 (GRCm39) probably null Het
Tmem235 A T 11: 117,751,674 (GRCm39) I33F possibly damaging Het
Tmem267 A T 13: 119,629,175 (GRCm39) probably null Het
Top1 G A 2: 160,556,185 (GRCm39) R548Q probably damaging Het
Trio T C 15: 27,805,908 (GRCm39) N527D probably damaging Het
Upf3a A G 8: 13,845,656 (GRCm39) K252E probably benign Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCCACTGACAAATTAGTCGCCC -3'
(R):5'- TCTGTTCATAAACGCCAACTCTGCC -3'

Sequencing Primer
(F):5'- GCTCTCTTCAAAGAAGCTGTGAC -3'
(R):5'- CGAAGGTCCATTACAAGACATTTAC -3'
Posted On 2013-06-11