Mutagenetix > Incidental Mutation

Incidental Mutation 'R5911:Gpr158'

460972

Institutional Source

Beutler Lab

Gene Symbol

Gpr158

Ensembl Gene

ENSMUSG00000045967

Gene Name

G protein-coupled receptor 158

Synonyms

5330427M13Rik

MMRRC Submission

044108-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5911 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

21367542-21830547 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21369121 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 289 (F289S)

Ref Sequence

ENSEMBL: ENSMUSP00000049708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055946]

AlphaFold

Q8C419

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055946
AA Change: F289S

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: F289S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	110	125	N/A	INTRINSIC
SCOP:d1edmb_	313	359	5e-4	SMART
Blast:EGF	318	365	2e-27	BLAST
Pfam:7tm_3	426	669	1.2e-35	PFAM
low complexity region	840	863	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133391

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155760

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

92% (77/84)

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003H04Rik	C	T	3: 124,556,731		probably benign	Het
4931417E11Rik	T	C	6: 73,468,691	T292A	probably damaging	Het
Acacb	A	T	5: 114,232,890	D1731V	probably damaging	Het
Afg3l1	G	A	8: 123,500,039	V563I	possibly damaging	Het
Ak7	A	G	12: 105,726,212	E175G	probably damaging	Het
Arhgap5	C	T	12: 52,518,742	T832I	possibly damaging	Het
Arid4a	A	T	12: 71,069,973	T602S	probably damaging	Het
Caps2	C	T	10: 112,165,686		probably benign	Het
Ccdc170	G	T	10: 4,558,551	E592*	probably null	Het
Clasp1	C	A	1: 118,506,908		probably benign	Het
Crhbp	T	A	13: 95,432,056	M291L	probably benign	Het
Cyp3a41b	T	A	5: 145,582,539	L47F	probably benign	Het
Dgcr6	A	G	16: 18,066,734	D82G	probably damaging	Het
Drc7	A	G	8: 95,074,126	E592G	probably damaging	Het
Dtl	G	A	1: 191,568,407	T115I	probably damaging	Het
Ece2	A	G	16: 20,638,760	Y338C	probably damaging	Het
Egr3	A	G	14: 70,079,448	D198G	probably damaging	Het
Ereg	A	C	5: 91,074,693		probably benign	Het
Esp31	G	C	17: 38,641,042		probably null	Het
Faap100	T	C	11: 120,377,132	I272V	possibly damaging	Het
Fam3c	T	C	6: 22,328,561	D109G	probably damaging	Het
Fam3c	T	A	6: 22,339,300	M51L	probably benign	Het
Fcnb	A	T	2: 28,076,689	N277K	probably damaging	Het
Fgfr1	A	G	8: 25,519,309		probably benign	Het
Grik4	C	A	9: 42,591,424	V468F	probably damaging	Het
Gtdc1	T	A	2: 44,752,064	R168S	probably benign	Het
Gucy2c	C	T	6: 136,722,442	G610R	probably damaging	Het
Gulp1	A	T	1: 44,754,374	Q65L	possibly damaging	Het
Hectd1	A	T	12: 51,802,252	D356E	probably damaging	Het
Hnrnpu	T	C	1: 178,330,172		probably benign	Het
Igkv13-57-2	T	C	6: 69,523,987		noncoding transcript	Het
Itih4	A	G	14: 30,890,655	I213V	possibly damaging	Het
Itpr2	T	C	6: 146,312,943	K1469E	probably benign	Het
Jrk	T	C	15: 74,705,768	D556G	possibly damaging	Het
Kctd16	A	T	18: 40,530,852	I345F	probably benign	Het
Klhdc1	A	G	12: 69,256,251	E187G	possibly damaging	Het
Lrch3	T	C	16: 32,959,463	Y111H	probably damaging	Het
Mlh3	A	T	12: 85,268,455	V319D	probably damaging	Het
Nsd3	T	C	8: 25,666,076	L553P	probably damaging	Het
Olfr1166	C	T	2: 88,124,683	V101I	probably benign	Het
Olfr382	T	A	11: 73,516,525	I225F	probably damaging	Het
Olfr490	T	A	7: 108,286,398	T243S	probably damaging	Het
Olfr513	T	A	7: 108,755,675	I273N	probably benign	Het
Olfr635	A	T	7: 103,979,708	H172L	probably benign	Het
Olfr844	T	C	9: 19,319,149	I205T	probably benign	Het
Pelp1	C	T	11: 70,396,914	R394H	probably damaging	Het
Ppp1r13l	G	T	7: 19,375,892		probably null	Het
Prr5	C	A	15: 84,701,434	S201*	probably null	Het
Rad23b	T	A	4: 55,370,474		probably null	Het
Rasgef1a	T	A	6: 118,084,374		probably null	Het
Ryr3	A	T	2: 112,908,487	I565N	probably damaging	Het
Slc30a5	T	C	13: 100,809,092	N527S	probably damaging	Het
Slc39a5	T	A	10: 128,399,943	N49Y	probably damaging	Het
Spast	T	A	17: 74,387,063	S571T	probably benign	Het
Spdye4c	C	T	2: 128,596,074	R245*	probably null	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Tgm7	T	A	2: 121,095,973	D480V	probably benign	Het
Thpo	T	A	16: 20,728,796	S22C	probably null	Het
Top2a	T	A	11: 99,016,465	T180S	possibly damaging	Het
Trim37	T	A	11: 87,196,837	Y34*	probably null	Het
Tsc2	T	C	17: 24,600,387	E1254G	possibly damaging	Het
Ttc39a	C	T	4: 109,422,971	P150L	possibly damaging	Het
Ttc4	T	C	4: 106,668,043	D298G	probably damaging	Het
Ttll1	A	G	15: 83,502,281	V41A	probably benign	Het
Vmn1r20	C	A	6: 57,431,789	H33Q	probably benign	Het
Zan	A	T	5: 137,457,912	Y1329N	unknown	Het

Other mutations in Gpr158

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Gpr158	APN	2	21368683	missense	probably damaging	1.00
IGL00469:Gpr158	APN	2	21746795	splice site	probably benign
IGL00706:Gpr158	APN	2	21746773	missense	probably damaging	1.00
IGL00780:Gpr158	APN	2	21826818	nonsense	probably null
IGL00885:Gpr158	APN	2	21649021	missense	probably damaging	1.00
IGL01339:Gpr158	APN	2	21369031	missense	possibly damaging	0.73
IGL01368:Gpr158	APN	2	21827098	missense	probably damaging	1.00
IGL02141:Gpr158	APN	2	21783290	missense	probably damaging	0.99
IGL02455:Gpr158	APN	2	21368700	missense	probably benign	0.00
IGL02554:Gpr158	APN	2	21826596	missense	probably benign
IGL02681:Gpr158	APN	2	21815630	missense	probably damaging	1.00
IGL02752:Gpr158	APN	2	21826827	missense	possibly damaging	0.95
IGL02756:Gpr158	APN	2	21827079	missense	possibly damaging	0.47
IGL03181:Gpr158	APN	2	21783161	missense	probably benign	0.02
IGL03258:Gpr158	APN	2	21825274	missense	probably damaging	1.00
IGL03386:Gpr158	APN	2	21826246	missense	probably damaging	1.00
PIT4810001:Gpr158	UTSW	2	21826871	missense	probably benign	0.01
R0071:Gpr158	UTSW	2	21810668	missense	probably benign	0.08
R0081:Gpr158	UTSW	2	21826717	missense	probably damaging	1.00
R0528:Gpr158	UTSW	2	21825208	missense	probably damaging	1.00
R0560:Gpr158	UTSW	2	21825274	missense	probably damaging	1.00
R0603:Gpr158	UTSW	2	21815669	missense	possibly damaging	0.67
R1560:Gpr158	UTSW	2	21826314	missense	probably damaging	1.00
R1561:Gpr158	UTSW	2	21815694	splice site	probably null
R1609:Gpr158	UTSW	2	21783293	missense	possibly damaging	0.61
R1741:Gpr158	UTSW	2	21827548	missense	probably benign	0.00
R1827:Gpr158	UTSW	2	21827318	missense	probably benign
R1854:Gpr158	UTSW	2	21369124	missense	probably damaging	1.00
R1871:Gpr158	UTSW	2	21815615	missense	probably damaging	1.00
R2151:Gpr158	UTSW	2	21827514	missense	possibly damaging	0.82
R2273:Gpr158	UTSW	2	21826863	missense	probably benign
R2275:Gpr158	UTSW	2	21826863	missense	probably benign
R3004:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R3151:Gpr158	UTSW	2	21576960	missense	possibly damaging	0.68
R3943:Gpr158	UTSW	2	21368559	missense	possibly damaging	0.65
R4238:Gpr158	UTSW	2	21368551	missense	probably damaging	1.00
R4379:Gpr158	UTSW	2	21825214	missense	probably damaging	1.00
R4381:Gpr158	UTSW	2	21827592	missense	probably damaging	1.00
R4464:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4467:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4496:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4506:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4530:Gpr158	UTSW	2	21369000	missense	probably benign	0.03
R4646:Gpr158	UTSW	2	21827053	missense	probably benign
R4798:Gpr158	UTSW	2	21783182	missense	probably damaging	1.00
R4882:Gpr158	UTSW	2	21825248	missense	probably damaging	0.98
R4943:Gpr158	UTSW	2	21827157	missense	probably damaging	1.00
R5334:Gpr158	UTSW	2	21827505	missense	probably benign	0.01
R5560:Gpr158	UTSW	2	21826290	missense	possibly damaging	0.67
R5600:Gpr158	UTSW	2	21827235	missense	probably benign
R5637:Gpr158	UTSW	2	21783272	missense	probably benign	0.00
R5701:Gpr158	UTSW	2	21746709	missense	probably damaging	1.00
R5744:Gpr158	UTSW	2	21368520	missense	probably damaging	1.00
R5991:Gpr158	UTSW	2	21368508	missense	probably damaging	0.99
R6200:Gpr158	UTSW	2	21399416	missense	probably damaging	0.97
R6306:Gpr158	UTSW	2	21815611	missense	possibly damaging	0.84
R6324:Gpr158	UTSW	2	21810554	missense	probably damaging	1.00
R6384:Gpr158	UTSW	2	21826288	missense	probably damaging	1.00
R6698:Gpr158	UTSW	2	21827110	missense	probably damaging	1.00
R6997:Gpr158	UTSW	2	21648991	missense	possibly damaging	0.46
R7086:Gpr158	UTSW	2	21826575	missense	probably benign	0.01
R7175:Gpr158	UTSW	2	21368302	missense	probably benign	0.13
R7197:Gpr158	UTSW	2	21810601	missense	probably damaging	0.99
R7293:Gpr158	UTSW	2	21576939	missense	possibly damaging	0.47
R7427:Gpr158	UTSW	2	21827318	missense	probably benign
R7515:Gpr158	UTSW	2	21368281	missense	probably damaging	1.00
R7730:Gpr158	UTSW	2	21826347	missense	probably damaging	1.00
R8122:Gpr158	UTSW	2	21826863	missense	probably benign
R8311:Gpr158	UTSW	2	21368890	missense	probably benign	0.00
R8754:Gpr158	UTSW	2	21576882	missense	probably benign	0.00
R8782:Gpr158	UTSW	2	21399338	missense	probably damaging	1.00
R8792:Gpr158	UTSW	2	21553326	missense	probably damaging	1.00
R8842:Gpr158	UTSW	2	21576940	missense	possibly damaging	0.88
R9009:Gpr158	UTSW	2	21576949	missense	probably damaging	1.00
R9102:Gpr158	UTSW	2	21825267	missense	probably damaging	1.00
R9150:Gpr158	UTSW	2	21826440	missense	probably benign	0.17
R9254:Gpr158	UTSW	2	21368231	start gained	probably benign
R9317:Gpr158	UTSW	2	21827226	missense	probably benign
R9379:Gpr158	UTSW	2	21368231	start gained	probably benign
R9428:Gpr158	UTSW	2	21783161	missense	probably benign
R9497:Gpr158	UTSW	2	21827014	missense	probably benign	0.00
R9667:Gpr158	UTSW	2	21825243	missense	probably damaging	0.99
R9681:Gpr158	UTSW	2	21826504	missense	probably damaging	0.99
X0062:Gpr158	UTSW	2	21826369	missense	probably damaging	1.00
Z1176:Gpr158	UTSW	2	21810690	critical splice donor site	probably null
Z1177:Gpr158	UTSW	2	21827272	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- TAACGCCACTCTAGAGACCG -3'
(R):5'- TCCGCATCCCTTAGTCTGAAG -3'

Sequencing Primer
(F):5'- CCACTCTAGAGACCGAGTGG -3'
(R):5'- AGTCTGAAGTTCAGTTCCAAGGC -3'

Posted On

2017-02-28