Incidental Mutation 'R0564:Tm9sf3'
ID 46098
Institutional Source Beutler Lab
Gene Symbol Tm9sf3
Ensembl Gene ENSMUSG00000025016
Gene Name transmembrane 9 superfamily member 3
Synonyms 2810031D16Rik, 1810073M23Rik, Smbp
MMRRC Submission 038755-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0564 (G1)
Quality Score 93
Status Validated
Chromosome 19
Chromosomal Location 41199283-41252436 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 41233964 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025989]
AlphaFold Q9ET30
Predicted Effect probably benign
Transcript: ENSMUST00000025989
SMART Domains Protein: ENSMUSP00000025989
Gene: ENSMUSG00000025016

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:EMP70 55 544 6.2e-164 PFAM
transmembrane domain 549 571 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl5 A G 10: 80,180,681 (GRCm39) V127A probably damaging Het
Alox12 T A 11: 70,143,662 (GRCm39) D202V probably damaging Het
Ankib1 A G 5: 3,779,655 (GRCm39) Y405H probably damaging Het
Apbb2 A T 5: 66,609,593 (GRCm39) M18K probably damaging Het
Atad2 C A 15: 57,989,229 (GRCm39) probably benign Het
Birc6 T A 17: 74,932,238 (GRCm39) probably benign Het
Ccdc126 T C 6: 49,311,076 (GRCm39) M28T possibly damaging Het
Cdc16 A T 8: 13,831,618 (GRCm39) D617V probably damaging Het
Cep135 G A 5: 76,763,557 (GRCm39) E516K probably damaging Het
Cep135 G T 5: 76,786,796 (GRCm39) M1081I probably benign Het
Col6a3 A C 1: 90,735,456 (GRCm39) V731G probably damaging Het
Cstdc6 A T 16: 36,143,346 (GRCm39) Y34* probably null Het
Cwc27 C A 13: 104,797,865 (GRCm39) E365* probably null Het
Dip2b C A 15: 100,060,600 (GRCm39) Y258* probably null Het
Dnah17 A G 11: 117,973,807 (GRCm39) V1900A probably damaging Het
Dpysl2 A T 14: 67,042,895 (GRCm39) probably benign Het
Dync2h1 A T 9: 7,139,432 (GRCm39) L1401Q probably damaging Het
Esf1 A T 2: 140,000,506 (GRCm39) Y427N possibly damaging Het
Fbln1 T A 15: 85,111,308 (GRCm39) V154D probably benign Het
Frem2 A G 3: 53,563,530 (GRCm39) F326L probably damaging Het
Gm4922 T A 10: 18,659,813 (GRCm39) N303I possibly damaging Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Iigp1 G A 18: 60,523,523 (GRCm39) V214M probably damaging Het
Luzp2 A G 7: 54,485,710 (GRCm39) K2E probably damaging Het
Mcc A G 18: 44,601,574 (GRCm39) L410P probably damaging Het
Mfn2 A G 4: 147,967,712 (GRCm39) F452S probably damaging Het
Mib2 C T 4: 155,743,917 (GRCm39) G42S probably damaging Het
Micu2 A G 14: 58,156,831 (GRCm39) F335L possibly damaging Het
Mpp3 T G 11: 101,896,173 (GRCm39) K450T possibly damaging Het
Mtmr4 T A 11: 87,489,714 (GRCm39) V79E probably damaging Het
Nlrp4b A G 7: 10,448,585 (GRCm39) I263V probably benign Het
Or52p2 T C 7: 102,237,738 (GRCm39) I71V probably benign Het
Or6c76 T G 10: 129,612,005 (GRCm39) V74G probably damaging Het
Pdk1 G A 2: 71,710,383 (GRCm39) W113* probably null Het
Phaf1 T A 8: 105,966,603 (GRCm39) probably benign Het
Phxr4 A T 9: 13,342,993 (GRCm39) probably benign Het
Rad51ap2 T A 12: 11,507,897 (GRCm39) H606Q probably benign Het
Ralgapa1 A T 12: 55,829,670 (GRCm39) I187K possibly damaging Het
Rps27 A G 3: 90,120,230 (GRCm39) probably benign Het
Sema3e T A 5: 14,286,099 (GRCm39) probably null Het
Sh2d3c G A 2: 32,643,064 (GRCm39) C749Y probably damaging Het
Siah2 T C 3: 58,583,656 (GRCm39) D210G probably benign Het
Smap2 G A 4: 120,834,174 (GRCm39) P155S probably benign Het
Snrk C T 9: 121,995,610 (GRCm39) T463M possibly damaging Het
Tmem132d C T 5: 127,861,842 (GRCm39) E760K probably damaging Het
Tmem184c A T 8: 78,332,789 (GRCm39) probably null Het
Tmem235 A T 11: 117,751,674 (GRCm39) I33F possibly damaging Het
Tmem267 A T 13: 119,629,175 (GRCm39) probably null Het
Top1 G A 2: 160,556,185 (GRCm39) R548Q probably damaging Het
Trio T C 15: 27,805,908 (GRCm39) N527D probably damaging Het
Upf3a A G 8: 13,845,656 (GRCm39) K252E probably benign Het
Other mutations in Tm9sf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Tm9sf3 APN 19 41,244,715 (GRCm39) missense probably damaging 1.00
IGL02176:Tm9sf3 APN 19 41,235,076 (GRCm39) splice site probably benign
PIT4687001:Tm9sf3 UTSW 19 41,206,630 (GRCm39) missense probably damaging 1.00
R0504:Tm9sf3 UTSW 19 41,236,331 (GRCm39) splice site probably benign
R0586:Tm9sf3 UTSW 19 41,244,582 (GRCm39) critical splice donor site probably null
R1224:Tm9sf3 UTSW 19 41,211,634 (GRCm39) missense probably damaging 1.00
R1533:Tm9sf3 UTSW 19 41,227,223 (GRCm39) missense probably benign 0.00
R1646:Tm9sf3 UTSW 19 41,211,618 (GRCm39) missense possibly damaging 0.79
R1748:Tm9sf3 UTSW 19 41,244,668 (GRCm39) missense probably benign 0.01
R2022:Tm9sf3 UTSW 19 41,227,231 (GRCm39) missense probably damaging 1.00
R2172:Tm9sf3 UTSW 19 41,205,859 (GRCm39) missense probably damaging 1.00
R3844:Tm9sf3 UTSW 19 41,205,555 (GRCm39) missense possibly damaging 0.95
R3878:Tm9sf3 UTSW 19 41,235,152 (GRCm39) missense probably damaging 0.98
R4384:Tm9sf3 UTSW 19 41,236,372 (GRCm39) missense probably damaging 1.00
R4385:Tm9sf3 UTSW 19 41,236,372 (GRCm39) missense probably damaging 1.00
R4582:Tm9sf3 UTSW 19 41,244,605 (GRCm39) missense probably damaging 1.00
R5497:Tm9sf3 UTSW 19 41,203,555 (GRCm39) missense probably benign 0.03
R5876:Tm9sf3 UTSW 19 41,229,023 (GRCm39) missense probably damaging 1.00
R6305:Tm9sf3 UTSW 19 41,233,881 (GRCm39) critical splice donor site probably null
R6924:Tm9sf3 UTSW 19 41,206,717 (GRCm39) missense probably damaging 1.00
R6936:Tm9sf3 UTSW 19 41,211,638 (GRCm39) missense probably benign 0.44
R7121:Tm9sf3 UTSW 19 41,233,944 (GRCm39) nonsense probably null
R7287:Tm9sf3 UTSW 19 41,205,818 (GRCm39) missense probably damaging 1.00
R7303:Tm9sf3 UTSW 19 41,227,198 (GRCm39) missense probably damaging 0.97
R7677:Tm9sf3 UTSW 19 41,209,743 (GRCm39) missense probably damaging 1.00
R8212:Tm9sf3 UTSW 19 41,229,074 (GRCm39) missense probably damaging 0.99
R8220:Tm9sf3 UTSW 19 41,203,526 (GRCm39) missense possibly damaging 0.80
R8715:Tm9sf3 UTSW 19 41,244,724 (GRCm39) missense probably damaging 1.00
X0026:Tm9sf3 UTSW 19 41,235,202 (GRCm39) nonsense probably null
X0026:Tm9sf3 UTSW 19 41,235,201 (GRCm39) missense possibly damaging 0.91
Z1088:Tm9sf3 UTSW 19 41,220,817 (GRCm39) missense probably damaging 1.00
Z1176:Tm9sf3 UTSW 19 41,227,248 (GRCm39) missense probably damaging 1.00
Z1177:Tm9sf3 UTSW 19 41,233,884 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAAATGGCCCACATACGCATTTTA -3'
(R):5'- TGGACCCACATGAGGAAAGCTGTAA -3'

Sequencing Primer
(F):5'- CCCTATGCTGAAAAAAGGATGG -3'
(R):5'- cacagacacagacacagacac -3'
Posted On 2013-06-11