Incidental Mutation 'R5911:Rad23b'
ID460982
Institutional Source Beutler Lab
Gene Symbol Rad23b
Ensembl Gene ENSMUSG00000028426
Gene NameRAD23 homolog B, nucleotide excision repair protein
Synonyms0610007D13Rik, mHR23B
MMRRC Submission 044108-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5911 (G1)
Quality Score214
Status Validated
Chromosome4
Chromosomal Location55350043-55392237 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 55370474 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030134]
PDB Structure
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
The Mouse PNGase-HR23 Complex Reveals a Complete Remodulation of the Protein-Protein Interface Compared to its Yeast Orthologs [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000030134
SMART Domains Protein: ENSMUSP00000030134
Gene: ENSMUSG00000028426

DomainStartEndE-ValueType
UBQ 1 75 8.79e-24 SMART
low complexity region 79 143 N/A INTRINSIC
UBA 190 227 3.1e-11 SMART
low complexity region 257 270 N/A INTRINSIC
STI1 274 317 3.37e-10 SMART
UBA 373 410 6.35e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156263
Meta Mutation Damage Score 0.9382 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of two human homologs of Saccharomyces cerevisiae Rad23, a protein involved in the nucleotide excision repair (NER). This protein was found to be a component of the protein complex that specifically complements the NER defect of xeroderma pigmentosum group C (XP-c) cell extracts in vitro. This protein was also shown to interact with, and elevate the nucleotide excision activity of 3-methyladenine-DNA glycosylase (MPG), which suggested a role in DNA damage recognition in base excision repair. This protein contains an N-terminal ubiquitin-like domain, which was reported to interact with 26S proteasome, and thus this protein may be involved in the ubiquitin mediated proteolytic pathway in cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene usually die around the time of birth. Those that survive show growth retardation, eye, reproductive, behavioral, and digestive system abnormalities. They usually die within 1 year of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Fgfr1 A G 8: 25,519,309 probably benign Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Grik4 C A 9: 42,591,424 V468F probably damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hectd1 A T 12: 51,802,252 D356E probably damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Jrk T C 15: 74,705,768 D556G possibly damaging Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Klhdc1 A G 12: 69,256,251 E187G possibly damaging Het
Lrch3 T C 16: 32,959,463 Y111H probably damaging Het
Mlh3 A T 12: 85,268,455 V319D probably damaging Het
Nsd3 T C 8: 25,666,076 L553P probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Pelp1 C T 11: 70,396,914 R394H probably damaging Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc30a5 T C 13: 100,809,092 N527S probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spast T A 17: 74,387,063 S571T probably benign Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Trim37 T A 11: 87,196,837 Y34* probably null Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttc4 T C 4: 106,668,043 D298G probably damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Rad23b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Rad23b APN 4 55366774 splice site probably benign
IGL01326:Rad23b APN 4 55383601 missense possibly damaging 0.95
IGL02398:Rad23b APN 4 55350360 utr 5 prime probably benign
IGL02506:Rad23b APN 4 55382511 missense probably benign 0.01
IGL02538:Rad23b APN 4 55370457 missense possibly damaging 0.67
Saguaro UTSW 4 55370474 critical splice donor site probably null
R0278:Rad23b UTSW 4 55383575 splice site probably null
R1846:Rad23b UTSW 4 55383637 nonsense probably null
R2198:Rad23b UTSW 4 55385497 missense possibly damaging 0.68
R2425:Rad23b UTSW 4 55385438 missense probably damaging 0.99
R3774:Rad23b UTSW 4 55382589 missense possibly damaging 0.95
R3781:Rad23b UTSW 4 55382586 missense probably damaging 1.00
R4197:Rad23b UTSW 4 55385455 missense probably damaging 0.98
R6056:Rad23b UTSW 4 55382540 missense probably benign 0.01
R6067:Rad23b UTSW 4 55370400 missense probably damaging 0.97
R6078:Rad23b UTSW 4 55370400 missense probably damaging 0.97
R6079:Rad23b UTSW 4 55370400 missense probably damaging 0.97
R7426:Rad23b UTSW 4 55370469 missense probably benign 0.00
U15987:Rad23b UTSW 4 55370400 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCTGTTTAACACATCCAGCCC -3'
(R):5'- GAGAGAAATTACATCAACCTGCATC -3'

Sequencing Primer
(F):5'- AGTTCTTCCCCAGCAGTGG -3'
(R):5'- TTACATCAACCTGCATCCTACAC -3'
Posted On2017-02-28