Incidental Mutation 'R5911:Nsd3'
ID461001
Institutional Source Beutler Lab
Gene Symbol Nsd3
Ensembl Gene ENSMUSG00000054823
Gene Namenuclear receptor binding SET domain protein 3
SynonymsWhsc1l1, WHISTLE
MMRRC Submission 044108-MU
Accession Numbers

Genbank: NM_001081269, NM_001001735.1; MGI: 2142581; Ensemb: ENSMUST00000155861, ENSMUST00000146919, ENSMUST00000142395, ENSMUST00000139966, ENSMUST00000153597, ENSMUST00000084026, ENSMUST0000017135

Is this an essential gene? Possibly essential (E-score: 0.507) question?
Stock #R5911 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location25601601-25719667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25666076 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 553 (L553P)
Ref Sequence ENSEMBL: ENSMUSP00000117596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084026] [ENSMUST00000136107] [ENSMUST00000139966] [ENSMUST00000142395] [ENSMUST00000143445] [ENSMUST00000146919] [ENSMUST00000155861]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084026
AA Change: L553P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081040
Gene: ENSMUSG00000054823
AA Change: L553P

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136107
AA Change: L553P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000139966
AA Change: L553P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122096
Gene: ENSMUSG00000054823
AA Change: L553P

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 914 5.24e-8 SMART
PWWP 919 981 8.62e-18 SMART
AWS 1054 1105 2.61e-17 SMART
SET 1106 1229 2.17e-41 SMART
PostSET 1230 1246 2.63e-3 SMART
low complexity region 1260 1277 N/A INTRINSIC
PHD 1283 1326 4.32e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000142395
AA Change: L553P

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117778
Gene: ENSMUSG00000054823
AA Change: L553P

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
PWWP 278 341 1.6e-12 SMART
low complexity region 680 701 N/A INTRINSIC
PHD 713 756 4.49e-7 SMART
PHD 761 808 5.82e-1 SMART
PHD 809 861 3.06e0 SMART
PHD 874 963 1e-4 SMART
PWWP 968 1030 8.62e-18 SMART
AWS 1103 1154 2.61e-17 SMART
SET 1155 1278 2.17e-41 SMART
PostSET 1279 1295 2.63e-3 SMART
low complexity region 1309 1326 N/A INTRINSIC
PHD 1332 1375 4.32e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143445
Predicted Effect probably damaging
Transcript: ENSMUST00000146919
AA Change: L553P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115470
Gene: ENSMUSG00000054823
AA Change: L553P

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
Pfam:PWWP 278 388 1.6e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155861
AA Change: L553P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117596
Gene: ENSMUSG00000054823
AA Change: L553P

DomainStartEndE-ValueType
low complexity region 128 151 N/A INTRINSIC
low complexity region 193 225 N/A INTRINSIC
Pfam:PWWP 278 388 1.6e-25 PFAM
Meta Mutation Damage Score 0.2671 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
MGI Phenotype FUNCTION: This gene encodes a member of the SET domain family of histone lysine N-methyltransferase proteins. This protein methylates histone H3 at lysine residues 4 and 27, which represses gene transcription. It acts in opposition to the histone demethylase Jmjd1c. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,556,731 probably benign Het
4931417E11Rik T C 6: 73,468,691 T292A probably damaging Het
Acacb A T 5: 114,232,890 D1731V probably damaging Het
Afg3l1 G A 8: 123,500,039 V563I possibly damaging Het
Ak7 A G 12: 105,726,212 E175G probably damaging Het
Arhgap5 C T 12: 52,518,742 T832I possibly damaging Het
Arid4a A T 12: 71,069,973 T602S probably damaging Het
Caps2 C T 10: 112,165,686 probably benign Het
Ccdc170 G T 10: 4,558,551 E592* probably null Het
Clasp1 C A 1: 118,506,908 probably benign Het
Crhbp T A 13: 95,432,056 M291L probably benign Het
Cyp3a41b T A 5: 145,582,539 L47F probably benign Het
Dgcr6 A G 16: 18,066,734 D82G probably damaging Het
Drc7 A G 8: 95,074,126 E592G probably damaging Het
Dtl G A 1: 191,568,407 T115I probably damaging Het
Ece2 A G 16: 20,638,760 Y338C probably damaging Het
Egr3 A G 14: 70,079,448 D198G probably damaging Het
Ereg A C 5: 91,074,693 probably benign Het
Esp31 G C 17: 38,641,042 probably null Het
Faap100 T C 11: 120,377,132 I272V possibly damaging Het
Fam3c T C 6: 22,328,561 D109G probably damaging Het
Fam3c T A 6: 22,339,300 M51L probably benign Het
Fcnb A T 2: 28,076,689 N277K probably damaging Het
Fgfr1 A G 8: 25,519,309 probably benign Het
Gpr158 T C 2: 21,369,121 F289S possibly damaging Het
Grik4 C A 9: 42,591,424 V468F probably damaging Het
Gtdc1 T A 2: 44,752,064 R168S probably benign Het
Gucy2c C T 6: 136,722,442 G610R probably damaging Het
Gulp1 A T 1: 44,754,374 Q65L possibly damaging Het
Hectd1 A T 12: 51,802,252 D356E probably damaging Het
Hnrnpu T C 1: 178,330,172 probably benign Het
Igkv13-57-2 T C 6: 69,523,987 noncoding transcript Het
Itih4 A G 14: 30,890,655 I213V possibly damaging Het
Itpr2 T C 6: 146,312,943 K1469E probably benign Het
Jrk T C 15: 74,705,768 D556G possibly damaging Het
Kctd16 A T 18: 40,530,852 I345F probably benign Het
Klhdc1 A G 12: 69,256,251 E187G possibly damaging Het
Lrch3 T C 16: 32,959,463 Y111H probably damaging Het
Mlh3 A T 12: 85,268,455 V319D probably damaging Het
Olfr1166 C T 2: 88,124,683 V101I probably benign Het
Olfr382 T A 11: 73,516,525 I225F probably damaging Het
Olfr490 T A 7: 108,286,398 T243S probably damaging Het
Olfr513 T A 7: 108,755,675 I273N probably benign Het
Olfr635 A T 7: 103,979,708 H172L probably benign Het
Olfr844 T C 9: 19,319,149 I205T probably benign Het
Pelp1 C T 11: 70,396,914 R394H probably damaging Het
Ppp1r13l G T 7: 19,375,892 probably null Het
Prr5 C A 15: 84,701,434 S201* probably null Het
Rad23b T A 4: 55,370,474 probably null Het
Rasgef1a T A 6: 118,084,374 probably null Het
Ryr3 A T 2: 112,908,487 I565N probably damaging Het
Slc30a5 T C 13: 100,809,092 N527S probably damaging Het
Slc39a5 T A 10: 128,399,943 N49Y probably damaging Het
Spast T A 17: 74,387,063 S571T probably benign Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Tgm7 T A 2: 121,095,973 D480V probably benign Het
Thpo T A 16: 20,728,796 S22C probably null Het
Top2a T A 11: 99,016,465 T180S possibly damaging Het
Trim37 T A 11: 87,196,837 Y34* probably null Het
Tsc2 T C 17: 24,600,387 E1254G possibly damaging Het
Ttc39a C T 4: 109,422,971 P150L possibly damaging Het
Ttc4 T C 4: 106,668,043 D298G probably damaging Het
Ttll1 A G 15: 83,502,281 V41A probably benign Het
Vmn1r20 C A 6: 57,431,789 H33Q probably benign Het
Zan A T 5: 137,457,912 Y1329N unknown Het
Other mutations in Nsd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Nsd3 APN 8 25676712 missense probably benign 0.40
IGL00718:Nsd3 APN 8 25706534 missense probably damaging 0.97
IGL00727:Nsd3 APN 8 25641158 missense probably damaging 1.00
IGL01324:Nsd3 APN 8 25662820 missense probably damaging 1.00
IGL01614:Nsd3 APN 8 25666079 missense possibly damaging 0.65
IGL01834:Nsd3 APN 8 25640652 missense probably damaging 1.00
IGL02066:Nsd3 APN 8 25713488 missense probably damaging 1.00
IGL02229:Nsd3 APN 8 25710748 missense probably damaging 0.98
IGL02481:Nsd3 APN 8 25691116 missense probably damaging 1.00
IGL02686:Nsd3 APN 8 25666070 missense probably damaging 0.96
IGL03394:Nsd3 APN 8 25675749 splice site probably benign
Pine UTSW 8 25679936 missense possibly damaging 0.87
D3080:Nsd3 UTSW 8 25713545 missense possibly damaging 0.77
IGL02802:Nsd3 UTSW 8 25640906 missense probably damaging 1.00
R0136:Nsd3 UTSW 8 25659854 nonsense probably null
R0195:Nsd3 UTSW 8 25680693 missense probably damaging 1.00
R0207:Nsd3 UTSW 8 25683257 missense probably benign 0.02
R0471:Nsd3 UTSW 8 25648434 splice site probably benign
R0511:Nsd3 UTSW 8 25678716 missense possibly damaging 0.81
R0524:Nsd3 UTSW 8 25700577 missense possibly damaging 0.90
R0581:Nsd3 UTSW 8 25710691 missense probably damaging 1.00
R0589:Nsd3 UTSW 8 25641287 missense probably damaging 1.00
R0645:Nsd3 UTSW 8 25709069 missense probably benign 0.08
R0664:Nsd3 UTSW 8 25714240 missense probably damaging 0.97
R0738:Nsd3 UTSW 8 25678709 splice site probably null
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1148:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1265:Nsd3 UTSW 8 25682562 missense probably benign
R1298:Nsd3 UTSW 8 25679936 missense possibly damaging 0.87
R1424:Nsd3 UTSW 8 25700566 missense probably damaging 1.00
R1493:Nsd3 UTSW 8 25713380 missense probably benign 0.09
R1528:Nsd3 UTSW 8 25698767 missense probably damaging 1.00
R2051:Nsd3 UTSW 8 25691089 missense probably damaging 0.99
R2199:Nsd3 UTSW 8 25666057 missense probably damaging 0.99
R3414:Nsd3 UTSW 8 25700019 missense probably damaging 1.00
R3522:Nsd3 UTSW 8 25706614 missense probably benign
R3623:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3624:Nsd3 UTSW 8 25662819 missense probably damaging 0.98
R3798:Nsd3 UTSW 8 25698845 missense probably damaging 1.00
R4345:Nsd3 UTSW 8 25641317 missense probably benign 0.04
R4370:Nsd3 UTSW 8 25648508 missense probably benign 0.13
R4421:Nsd3 UTSW 8 25641272 missense probably damaging 0.99
R4583:Nsd3 UTSW 8 25710676 missense probably benign 0.20
R4664:Nsd3 UTSW 8 25698866 missense probably damaging 1.00
R4741:Nsd3 UTSW 8 25673366 missense probably damaging 1.00
R4876:Nsd3 UTSW 8 25691134 missense possibly damaging 0.94
R4888:Nsd3 UTSW 8 25698911 missense probably damaging 1.00
R5000:Nsd3 UTSW 8 25682577 missense probably damaging 1.00
R5132:Nsd3 UTSW 8 25678839 missense possibly damaging 0.73
R5632:Nsd3 UTSW 8 25679969 missense probably benign 0.00
R5760:Nsd3 UTSW 8 25659756 missense probably damaging 1.00
R5778:Nsd3 UTSW 8 25659818 missense probably damaging 1.00
R5779:Nsd3 UTSW 8 25682669 nonsense probably null
R5860:Nsd3 UTSW 8 25666091 missense probably damaging 0.98
R6168:Nsd3 UTSW 8 25691161 missense probably null 1.00
R6467:Nsd3 UTSW 8 25640630 missense probably damaging 1.00
R6490:Nsd3 UTSW 8 25714185 missense probably damaging 1.00
R6519:Nsd3 UTSW 8 25662939 missense probably damaging 1.00
R6554:Nsd3 UTSW 8 25662875 missense probably damaging 0.99
R7038:Nsd3 UTSW 8 25641263 missense probably damaging 1.00
R7088:Nsd3 UTSW 8 25666034 missense probably benign 0.40
R7244:Nsd3 UTSW 8 25666039 missense probably damaging 0.96
R7308:Nsd3 UTSW 8 25640724 missense probably damaging 1.00
R7678:Nsd3 UTSW 8 25659817 missense possibly damaging 0.82
R7717:Nsd3 UTSW 8 25682562 missense probably benign
R8064:Nsd3 UTSW 8 25700670 nonsense probably null
X0026:Nsd3 UTSW 8 25700593 missense probably damaging 1.00
Z1088:Nsd3 UTSW 8 25641002 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TACTTATCACCTGGACTTAAGGC -3'
(R):5'- CAGTATGTCATTATGGCCTGCCTTC -3'

Sequencing Primer
(F):5'- GTCACGTTAAGCCATCTG -3'
(R):5'- GTCATTATGGCCTGCCTTCATTCAC -3'
Posted On2017-02-28