Incidental Mutation 'R0565:Ppp1r15b'
ID46101
Institutional Source Beutler Lab
Gene Symbol Ppp1r15b
Ensembl Gene ENSMUSG00000046062
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 15b
Synonyms1810033K10Rik, CReP, C530022L24Rik
MMRRC Submission 038756-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0565 (G1)
Quality Score160
Status Validated
Chromosome1
Chromosomal Location133131143-133139783 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 133136653 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000057062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052529]
Predicted Effect probably benign
Transcript: ENSMUST00000052529
SMART Domains Protein: ENSMUSP00000057062
Gene: ENSMUSG00000046062

DomainStartEndE-ValueType
Pfam:CReP_N 1 394 1.3e-205 PFAM
Pfam:PP1c_bdg 397 682 1.5e-154 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193049
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195676
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein phosphatase I-interacting protein that promotes the dephosphorylation of eukaryotic translation initiation factor 2A to regulate translation under conditions of cellular stress. The transcribed messenger RNA contains two upstream open reading frames (ORFs) that repress translation of the main protein coding ORF under normal conditions, while the protein coding ORF is expressed at high levels in response to stress. Continual translation of the mRNA under conditions of eukaryotic translation initiation factor 2A inactivation is thought to create a feedback loop for reactivation of the gene during recovery from stress. In addition, it has been shown that this protein plays a role in membrane traffic that is independent of translation and that it is required for exocytosis from erythroleukemia cells. Allelic variants of this gene are associated with microcephaly, short stature, and impaired glucose metabolism. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a null allele die within the first day after birth with decreased weight at birth and red blood cell counts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,864,336 H1010L probably benign Het
A2ml1 C A 6: 128,568,743 E474* probably null Het
Agtr1b T C 3: 20,315,674 H256R probably damaging Het
Amacr C T 15: 10,981,946 A46V possibly damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Caskin2 T C 11: 115,801,016 E981G probably damaging Het
Ccdc88a A G 11: 29,461,042 probably benign Het
Cd180 A G 13: 102,702,874 probably benign Het
Cemip G A 7: 83,964,110 H627Y probably damaging Het
Cep131 G T 11: 120,073,762 H289Q probably damaging Het
Cep350 G A 1: 155,961,195 probably benign Het
Cfap52 A T 11: 67,949,599 C169S probably benign Het
Cps1 A T 1: 67,166,449 T544S possibly damaging Het
Cul7 T C 17: 46,652,003 S187P probably damaging Het
Dhx40 C A 11: 86,771,167 R688L probably damaging Het
E330034G19Rik C A 14: 24,306,917 Q174K probably benign Het
Efna5 T C 17: 62,881,036 Y32C probably damaging Het
Ethe1 A G 7: 24,607,889 H176R probably benign Het
Exoc3 A G 13: 74,182,275 probably null Het
Fam135b T A 15: 71,490,837 N232Y possibly damaging Het
Fam214b A T 4: 43,034,647 probably benign Het
Fndc9 C T 11: 46,238,157 L168F probably damaging Het
Fpr-rs3 G A 17: 20,624,021 A286V probably damaging Het
Gm609 T A 16: 45,444,173 probably benign Het
Immt T A 6: 71,846,483 probably benign Het
Ipo7 T C 7: 110,049,593 probably benign Het
Ipo8 A T 6: 148,786,723 L747H probably damaging Het
Ireb2 A T 9: 54,899,983 N610Y probably damaging Het
Irs2 A G 8: 11,004,592 V1280A probably damaging Het
Kcnj3 T A 2: 55,595,264 M458K probably benign Het
Kl A G 5: 150,980,944 K387R possibly damaging Het
L3mbtl2 C A 15: 81,684,286 probably benign Het
Lamb1 A C 12: 31,298,915 I649L probably benign Het
Lipm A C 19: 34,116,506 L274F probably benign Het
Lrfn3 A G 7: 30,360,791 V3A probably benign Het
Lrrc8c A C 5: 105,607,028 D223A probably damaging Het
Ltn1 C A 16: 87,416,010 K554N probably benign Het
Mertk T C 2: 128,771,483 I473T probably benign Het
Mfsd12 C A 10: 81,361,409 N245K probably benign Het
Mmp16 A G 4: 17,987,705 D89G probably damaging Het
Myo5a T A 9: 75,180,112 N1083K probably benign Het
Ncapd3 C T 9: 27,087,998 A1290V probably benign Het
Nefm A G 14: 68,124,621 S65P probably damaging Het
Nt5c2 C T 19: 46,897,625 R220H probably damaging Het
Olfr1189 T A 2: 88,592,009 D68E probably benign Het
Osbpl1a A T 18: 12,759,444 S438R probably damaging Het
Pcdhb5 T C 18: 37,320,767 S67P possibly damaging Het
Per3 A T 4: 151,033,952 I228N probably damaging Het
Pnpla7 T G 2: 24,980,117 probably benign Het
Psmd2 G T 16: 20,660,426 L678F probably null Het
Ptch2 A G 4: 117,106,143 probably benign Het
Ranbp2 T A 10: 58,476,336 D959E probably benign Het
Rph3al C T 11: 75,833,401 probably null Het
Sec31b T A 19: 44,524,553 E499V probably damaging Het
Sel1l T C 12: 91,811,889 I667M probably benign Het
Sel1l C A 12: 91,813,945 V641L possibly damaging Het
Slc7a1 T A 5: 148,352,069 I123F probably damaging Het
Smarca2 G A 19: 26,681,875 R855Q possibly damaging Het
Sphk1 G T 11: 116,536,358 probably benign Het
Spink12 C A 18: 44,104,688 S11* probably null Het
Sstr2 A T 11: 113,625,619 I342F probably benign Het
Stxbp1 T C 2: 32,819,848 T78A probably benign Het
Trim11 T A 11: 58,990,584 S434R probably damaging Het
Ubr2 T C 17: 46,955,886 E1113G probably damaging Het
Upb1 T A 10: 75,428,354 probably benign Het
Vit T A 17: 78,624,837 C458S probably damaging Het
Vmn1r58 T C 7: 5,411,166 I22V probably benign Het
Vps25 T C 11: 101,258,905 probably benign Het
Wbp2 G T 11: 116,082,385 D65E possibly damaging Het
Wdr72 A G 9: 74,217,306 D980G probably benign Het
Xkr8 A C 4: 132,730,917 probably null Het
Other mutations in Ppp1r15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:Ppp1r15b APN 1 133132023 missense probably benign 0.15
IGL02803:Ppp1r15b APN 1 133133343 missense probably damaging 1.00
R0102:Ppp1r15b UTSW 1 133133170 missense probably damaging 1.00
R0102:Ppp1r15b UTSW 1 133133170 missense probably damaging 1.00
R1513:Ppp1r15b UTSW 1 133133350 missense probably benign 0.06
R1604:Ppp1r15b UTSW 1 133132549 missense probably benign 0.21
R1932:Ppp1r15b UTSW 1 133131625 start gained probably benign
R4084:Ppp1r15b UTSW 1 133133067 missense probably damaging 1.00
R4687:Ppp1r15b UTSW 1 133132135 missense probably benign 0.00
R5654:Ppp1r15b UTSW 1 133131644 start gained probably benign
R6181:Ppp1r15b UTSW 1 133132523 nonsense probably null
X0025:Ppp1r15b UTSW 1 133132300 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGTTGTCTCCACTGTGGTTACCC -3'
(R):5'- TCTCTGTGCTCAAAGGCCAAGC -3'

Sequencing Primer
(F):5'- CACTGTGGTTACCCTCTGAG -3'
(R):5'- CAGTAGCCAATGGCAACTTCTG -3'
Posted On2013-06-11