Incidental Mutation 'R5911:Prr5'
ID 461027
Institutional Source Beutler Lab
Gene Symbol Prr5
Ensembl Gene ENSMUSG00000036106
Gene Name proline rich 5 (renal)
Synonyms Protor-1, C030017C09Rik
MMRRC Submission 044108-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R5911 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 84553821-84587874 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 84585635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 201 (S201*)
Ref Sequence ENSEMBL: ENSMUSP00000127890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065499] [ENSMUST00000171460]
AlphaFold Q812A5
Predicted Effect probably null
Transcript: ENSMUST00000065499
AA Change: S210*
SMART Domains Protein: ENSMUSP00000066396
Gene: ENSMUSG00000036106
AA Change: S210*

DomainStartEndE-ValueType
Pfam:HbrB 38 144 6.9e-17 PFAM
low complexity region 333 344 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171460
AA Change: S201*
SMART Domains Protein: ENSMUSP00000127890
Gene: ENSMUSG00000036106
AA Change: S201*

DomainStartEndE-ValueType
Pfam:HbrB 27 159 1.3e-36 PFAM
low complexity region 324 335 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 92% (77/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a proline-rich domain. This gene is located in a region of chromosome 22 reported to contain a tumor suppressor gene that may be involved in breast and colorectal tumorigenesis. The protein is a component of the mammalian target of rapamycin complex 2 (mTORC2), and it regulates platelet-derived growth factor (PDGF) receptor beta expression and PDGF signaling to Akt and S6K1. Alternative splicing and the use of alternative promoters results in transcripts encoding different isoforms. Read-through transcripts from this gene into the downstream Rho GTPase activating protein 8 (ARHGAP8) gene also exist, which led to the original description of PRR5 and ARHGAP8 being a single gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik C T 3: 124,350,380 (GRCm39) probably benign Het
Acacb A T 5: 114,370,951 (GRCm39) D1731V probably damaging Het
Afg3l1 G A 8: 124,226,778 (GRCm39) V563I possibly damaging Het
Ak7 A G 12: 105,692,471 (GRCm39) E175G probably damaging Het
Arhgap5 C T 12: 52,565,525 (GRCm39) T832I possibly damaging Het
Arid4a A T 12: 71,116,747 (GRCm39) T602S probably damaging Het
Caps2 C T 10: 112,001,591 (GRCm39) probably benign Het
Ccdc170 G T 10: 4,508,551 (GRCm39) E592* probably null Het
Clasp1 C A 1: 118,434,638 (GRCm39) probably benign Het
Crhbp T A 13: 95,568,564 (GRCm39) M291L probably benign Het
Cyp3a41b T A 5: 145,519,349 (GRCm39) L47F probably benign Het
Dgcr6 A G 16: 17,884,598 (GRCm39) D82G probably damaging Het
Drc7 A G 8: 95,800,754 (GRCm39) E592G probably damaging Het
Dtl G A 1: 191,300,519 (GRCm39) T115I probably damaging Het
Ece2 A G 16: 20,457,510 (GRCm39) Y338C probably damaging Het
Egr3 A G 14: 70,316,897 (GRCm39) D198G probably damaging Het
Ereg A C 5: 91,222,552 (GRCm39) probably benign Het
Esp31 G C 17: 38,951,933 (GRCm39) probably null Het
Faap100 T C 11: 120,267,958 (GRCm39) I272V possibly damaging Het
Fam3c T C 6: 22,328,560 (GRCm39) D109G probably damaging Het
Fam3c T A 6: 22,339,299 (GRCm39) M51L probably benign Het
Fcnb A T 2: 27,966,701 (GRCm39) N277K probably damaging Het
Fgfr1 A G 8: 26,009,325 (GRCm39) probably benign Het
Gpr158 T C 2: 21,373,932 (GRCm39) F289S possibly damaging Het
Grik4 C A 9: 42,502,720 (GRCm39) V468F probably damaging Het
Gtdc1 T A 2: 44,642,076 (GRCm39) R168S probably benign Het
Gucy2c C T 6: 136,699,440 (GRCm39) G610R probably damaging Het
Gulp1 A T 1: 44,793,534 (GRCm39) Q65L possibly damaging Het
Hectd1 A T 12: 51,849,035 (GRCm39) D356E probably damaging Het
Hnrnpu T C 1: 178,157,737 (GRCm39) probably benign Het
Igkv13-57-2 T C 6: 69,500,971 (GRCm39) noncoding transcript Het
Itih4 A G 14: 30,612,612 (GRCm39) I213V possibly damaging Het
Itpr2 T C 6: 146,214,441 (GRCm39) K1469E probably benign Het
Jkampl T C 6: 73,445,674 (GRCm39) T292A probably damaging Het
Jrk T C 15: 74,577,617 (GRCm39) D556G possibly damaging Het
Kctd16 A T 18: 40,663,905 (GRCm39) I345F probably benign Het
Klhdc1 A G 12: 69,303,025 (GRCm39) E187G possibly damaging Het
Lrch3 T C 16: 32,779,833 (GRCm39) Y111H probably damaging Het
Mlh3 A T 12: 85,315,229 (GRCm39) V319D probably damaging Het
Nsd3 T C 8: 26,156,092 (GRCm39) L553P probably damaging Het
Or1e23 T A 11: 73,407,351 (GRCm39) I225F probably damaging Het
Or51q1 A T 7: 103,628,915 (GRCm39) H172L probably benign Het
Or5d38 C T 2: 87,955,027 (GRCm39) V101I probably benign Het
Or5e1 T A 7: 108,354,882 (GRCm39) I273N probably benign Het
Or5p66 T A 7: 107,885,605 (GRCm39) T243S probably damaging Het
Or7g26 T C 9: 19,230,445 (GRCm39) I205T probably benign Het
Pelp1 C T 11: 70,287,740 (GRCm39) R394H probably damaging Het
Ppp1r13l G T 7: 19,109,817 (GRCm39) probably null Het
Rad23b T A 4: 55,370,474 (GRCm39) probably null Het
Rasgef1a T A 6: 118,061,335 (GRCm39) probably null Het
Ryr3 A T 2: 112,738,832 (GRCm39) I565N probably damaging Het
Slc30a5 T C 13: 100,945,600 (GRCm39) N527S probably damaging Het
Slc39a5 T A 10: 128,235,812 (GRCm39) N49Y probably damaging Het
Spast T A 17: 74,694,058 (GRCm39) S571T probably benign Het
Spdye4c C T 2: 128,437,994 (GRCm39) R245* probably null Het
Tbc1d2 C T 4: 46,629,912 (GRCm39) G252R probably benign Het
Tgm7 T A 2: 120,926,454 (GRCm39) D480V probably benign Het
Thpo T A 16: 20,547,546 (GRCm39) S22C probably null Het
Top2a T A 11: 98,907,291 (GRCm39) T180S possibly damaging Het
Trim37 T A 11: 87,087,663 (GRCm39) Y34* probably null Het
Tsc2 T C 17: 24,819,361 (GRCm39) E1254G possibly damaging Het
Ttc39a C T 4: 109,280,168 (GRCm39) P150L possibly damaging Het
Ttc4 T C 4: 106,525,240 (GRCm39) D298G probably damaging Het
Ttll1 A G 15: 83,386,482 (GRCm39) V41A probably benign Het
Vmn1r20 C A 6: 57,408,774 (GRCm39) H33Q probably benign Het
Zan A T 5: 137,456,174 (GRCm39) Y1329N unknown Het
Other mutations in Prr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Prr5 APN 15 84,583,856 (GRCm39) missense possibly damaging 0.47
IGL01790:Prr5 APN 15 84,651,415 (GRCm39) missense possibly damaging 0.87
IGL01950:Prr5 APN 15 84,650,550 (GRCm39) missense probably benign 0.33
IGL02156:Prr5 APN 15 84,654,236 (GRCm39) missense possibly damaging 0.87
IGL02656:Prr5 APN 15 84,583,337 (GRCm39) missense probably damaging 1.00
IGL03102:Prr5 APN 15 84,650,508 (GRCm39) splice site probably benign
R0234:Prr5 UTSW 15 84,587,322 (GRCm39) missense probably damaging 1.00
R0234:Prr5 UTSW 15 84,587,322 (GRCm39) missense probably damaging 1.00
R0389:Prr5 UTSW 15 84,587,152 (GRCm39) missense probably benign 0.00
R0514:Prr5 UTSW 15 84,586,967 (GRCm39) missense probably benign 0.19
R1414:Prr5 UTSW 15 84,583,912 (GRCm39) nonsense probably null
R2027:Prr5 UTSW 15 84,585,580 (GRCm39) missense probably damaging 0.99
R2230:Prr5 UTSW 15 84,586,981 (GRCm39) missense probably benign 0.15
R2231:Prr5 UTSW 15 84,586,981 (GRCm39) missense probably benign 0.15
R2232:Prr5 UTSW 15 84,586,981 (GRCm39) missense probably benign 0.15
R3003:Prr5 UTSW 15 84,656,031 (GRCm39) missense probably damaging 0.99
R3498:Prr5 UTSW 15 84,587,345 (GRCm39) missense probably benign 0.12
R3791:Prr5 UTSW 15 84,565,417 (GRCm39) missense probably damaging 1.00
R3910:Prr5 UTSW 15 84,587,345 (GRCm39) missense probably benign 0.12
R4562:Prr5 UTSW 15 84,626,114 (GRCm39) missense probably damaging 0.99
R4866:Prr5 UTSW 15 84,626,105 (GRCm39) missense probably damaging 1.00
R4867:Prr5 UTSW 15 84,624,967 (GRCm39) missense probably benign 0.17
R5514:Prr5 UTSW 15 84,587,096 (GRCm39) missense probably benign 0.01
R5620:Prr5 UTSW 15 84,640,570 (GRCm39) missense probably benign 0.09
R5793:Prr5 UTSW 15 84,656,223 (GRCm39) missense probably benign
R5905:Prr5 UTSW 15 84,626,178 (GRCm39) missense possibly damaging 0.53
R6033:Prr5 UTSW 15 84,626,126 (GRCm39) missense probably damaging 1.00
R6033:Prr5 UTSW 15 84,626,126 (GRCm39) missense probably damaging 1.00
R6085:Prr5 UTSW 15 84,572,106 (GRCm39) missense probably damaging 1.00
R6187:Prr5 UTSW 15 84,577,973 (GRCm39) missense probably damaging 1.00
R6394:Prr5 UTSW 15 84,583,925 (GRCm39) missense probably damaging 0.99
R6422:Prr5 UTSW 15 84,578,005 (GRCm39) missense probably damaging 1.00
R6631:Prr5 UTSW 15 84,586,978 (GRCm39) missense probably damaging 0.99
R7212:Prr5 UTSW 15 84,629,993 (GRCm39) missense probably null 0.99
R7548:Prr5 UTSW 15 84,641,259 (GRCm39) missense possibly damaging 0.76
R7614:Prr5 UTSW 15 84,641,276 (GRCm39) missense probably benign 0.44
R7822:Prr5 UTSW 15 84,649,933 (GRCm39) missense probably damaging 1.00
R8113:Prr5 UTSW 15 84,577,993 (GRCm39) missense probably damaging 1.00
R8268:Prr5 UTSW 15 84,587,192 (GRCm39) missense probably benign 0.02
R8328:Prr5 UTSW 15 84,587,387 (GRCm39) makesense probably null
R8488:Prr5 UTSW 15 84,578,005 (GRCm39) missense probably damaging 1.00
R8874:Prr5 UTSW 15 84,583,916 (GRCm39) missense probably damaging 1.00
R9058:Prr5 UTSW 15 84,641,241 (GRCm39) missense probably benign 0.00
R9317:Prr5 UTSW 15 84,583,324 (GRCm39) nonsense probably null
R9456:Prr5 UTSW 15 84,585,682 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATAAGGGAGCCTAGCCTCCTG -3'
(R):5'- ATCACTGTTCTGGGAGTTGCC -3'

Sequencing Primer
(F):5'- TAGCCTCCTGCCTGGGACTC -3'
(R):5'- TACCCCGTCTACCCTGAAGG -3'
Posted On 2017-02-28