Incidental Mutation 'R5912:Sulf1'
ID461036
Institutional Source Beutler Lab
Gene Symbol Sulf1
Ensembl Gene ENSMUSG00000016918
Gene Namesulfatase 1
Synonyms
MMRRC Submission 044109-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.498) question?
Stock #R5912 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location12692277-12861192 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 12786752 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088585] [ENSMUST00000177608] [ENSMUST00000180062] [ENSMUST00000186051] [ENSMUST00000186405] [ENSMUST00000189541]
Predicted Effect probably benign
Transcript: ENSMUST00000088585
SMART Domains Protein: ENSMUSP00000085949
Gene: ENSMUSG00000016918

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177608
SMART Domains Protein: ENSMUSP00000137523
Gene: ENSMUSG00000016918

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 534 678 9.7e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180062
SMART Domains Protein: ENSMUSP00000136014
Gene: ENSMUSG00000016918

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.7e-59 PFAM
Pfam:Phosphodiest 61 323 9.2e-11 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 5e-52 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186051
SMART Domains Protein: ENSMUSP00000141153
Gene: ENSMUSG00000016918

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sulfatase 43 374 7.4e-56 PFAM
Pfam:Phosphodiest 61 323 9.6e-8 PFAM
low complexity region 512 523 N/A INTRINSIC
Pfam:DUF3740 533 679 1.1e-48 PFAM
low complexity region 717 737 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187376
Predicted Effect probably benign
Transcript: ENSMUST00000189541
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular heparan sulfate endosulfatase. The encoded enzyme selectively removes 6-O-sulfate groups from heparan sulfate chains of heparan sulfate proteoglycans (HSPGs). The enzyme is secreted through the Golgi and is subsequently localized to the cell surface. The expression of this gene may be down-regulated in several types of cancer, including hepatocellular (HCC), ovarian and breast cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a null allele display a slight increase in mortality early in life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,696 C166S possibly damaging Het
Ahnak T A 19: 9,011,903 M3517K probably damaging Het
Asap2 T C 12: 21,206,343 V214A probably damaging Het
Atp13a4 A G 16: 29,456,571 V365A probably benign Het
Bivm G T 1: 44,126,413 G8* probably null Het
Cc2d2a A C 5: 43,720,430 D1043A probably damaging Het
Cdh2 A C 18: 16,640,450 I331S possibly damaging Het
Clip3 A C 7: 30,298,870 D247A probably benign Het
Csf3r A T 4: 126,029,960 I88F probably damaging Het
Cyp2j13 A T 4: 96,056,842 N316K probably damaging Het
Dnah12 T A 14: 26,770,008 C1133* probably null Het
Glud1 G A 14: 34,311,343 probably null Het
Gm5805 A G 15: 81,972,817 noncoding transcript Het
Gsg1l2 G T 11: 67,774,714 probably null Het
Ikzf1 C A 11: 11,748,464 S105* probably null Het
Kif18b A G 11: 102,912,991 S448P probably benign Het
Klhl31 C A 9: 77,655,730 N592K probably damaging Het
Kmt2c A G 5: 25,347,469 F1239L possibly damaging Het
Lama5 A G 2: 180,195,475 Y1014H probably damaging Het
Macf1 A C 4: 123,397,158 L3980R probably damaging Het
Magi1 A T 6: 93,708,145 S524T possibly damaging Het
Nlrp4f A T 13: 65,194,908 Y308N probably damaging Het
Olfr393 A C 11: 73,847,675 I150R possibly damaging Het
Olfr402 A T 11: 74,155,220 E22V possibly damaging Het
Rfx5 G A 3: 94,958,718 probably benign Het
Scn1b C T 7: 31,117,803 V165M probably damaging Het
Sema4c A C 1: 36,554,388 V41G possibly damaging Het
Serpini1 G T 3: 75,616,607 G174V probably benign Het
Sh2b1 T C 7: 126,471,470 E353G probably damaging Het
Slc7a6 G T 8: 106,179,657 V174L probably benign Het
Smg1 A T 7: 118,154,586 probably benign Het
Spag9 A G 11: 94,044,425 N21D probably damaging Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Swt1 A G 1: 151,411,409 S111P probably damaging Het
Syne2 G A 12: 75,908,947 probably null Het
Tanc1 T C 2: 59,791,686 V383A possibly damaging Het
Tbc1d10b G T 7: 127,199,861 A491E probably damaging Het
Tek A G 4: 94,798,640 T132A probably damaging Het
Traf3 A G 12: 111,255,349 I290V probably benign Het
Traf5 A G 1: 191,998,069 probably benign Het
Ttn A T 2: 76,810,343 I13687N probably damaging Het
Unc5c A G 3: 141,789,006 D415G probably damaging Het
Ust A G 10: 8,298,061 Y227H probably benign Het
Vmn2r100 A G 17: 19,531,809 N705D probably damaging Het
Wnk2 T C 13: 49,060,774 E1444G probably damaging Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zbtb5 A G 4: 44,993,750 S545P probably benign Het
Zfp710 A G 7: 80,081,474 D133G probably benign Het
Zfp866 A T 8: 69,766,284 C229S probably benign Het
Other mutations in Sulf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Sulf1 APN 1 12820463 missense probably damaging 0.99
IGL00788:Sulf1 APN 1 12848449 missense probably damaging 0.99
IGL00845:Sulf1 APN 1 12796967 missense probably damaging 1.00
IGL01606:Sulf1 APN 1 12836204 missense possibly damaging 0.87
IGL01963:Sulf1 APN 1 12818507 missense probably damaging 1.00
IGL01968:Sulf1 APN 1 12818451 missense probably damaging 1.00
IGL02072:Sulf1 APN 1 12848208 missense probably damaging 1.00
IGL02424:Sulf1 APN 1 12796840 missense probably benign 0.28
IGL02519:Sulf1 APN 1 12838363 nonsense probably null
IGL02601:Sulf1 APN 1 12786645 missense probably damaging 1.00
IGL03066:Sulf1 APN 1 12807944 missense probably damaging 0.99
IGL03200:Sulf1 APN 1 12786617 nonsense probably null
PIT4480001:Sulf1 UTSW 1 12859413 missense probably benign 0.01
PIT4519001:Sulf1 UTSW 1 12848171 missense probably damaging 1.00
R0083:Sulf1 UTSW 1 12817417 missense probably damaging 0.99
R0467:Sulf1 UTSW 1 12796920 missense probably damaging 1.00
R0554:Sulf1 UTSW 1 12805194 missense probably damaging 1.00
R0626:Sulf1 UTSW 1 12817492 splice site probably null
R1083:Sulf1 UTSW 1 12836164 frame shift probably null
R1084:Sulf1 UTSW 1 12836164 frame shift probably null
R1498:Sulf1 UTSW 1 12848350 missense probably damaging 1.00
R1523:Sulf1 UTSW 1 12817350 nonsense probably null
R1854:Sulf1 UTSW 1 12838437 missense probably benign 0.06
R1942:Sulf1 UTSW 1 12848173 missense probably damaging 1.00
R1946:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R1998:Sulf1 UTSW 1 12858834 nonsense probably null
R2034:Sulf1 UTSW 1 12820421 missense probably damaging 1.00
R2068:Sulf1 UTSW 1 12840403 missense probably damaging 1.00
R2113:Sulf1 UTSW 1 12848174 missense probably damaging 0.99
R2277:Sulf1 UTSW 1 12796794 missense probably benign 0.41
R3827:Sulf1 UTSW 1 12817432 missense probably benign
R3874:Sulf1 UTSW 1 12817412 missense probably damaging 1.00
R4488:Sulf1 UTSW 1 12786515 start gained probably benign
R4619:Sulf1 UTSW 1 12786652 missense probably damaging 1.00
R4743:Sulf1 UTSW 1 12836293 missense probably benign 0.04
R4836:Sulf1 UTSW 1 12842686 missense probably benign 0.02
R4918:Sulf1 UTSW 1 12818496 missense probably damaging 1.00
R4958:Sulf1 UTSW 1 12796910 missense probably benign 0.08
R5216:Sulf1 UTSW 1 12796874 missense probably benign 0.28
R5225:Sulf1 UTSW 1 12841478 missense probably benign
R5427:Sulf1 UTSW 1 12796912 missense possibly damaging 0.84
R5450:Sulf1 UTSW 1 12796907 missense probably benign 0.04
R5909:Sulf1 UTSW 1 12858815 missense possibly damaging 0.94
R5966:Sulf1 UTSW 1 12859412 missense probably benign 0.06
R6339:Sulf1 UTSW 1 12838440 missense probably damaging 1.00
R6841:Sulf1 UTSW 1 12838434 missense probably damaging 1.00
R6880:Sulf1 UTSW 1 12842755 missense probably damaging 1.00
R7110:Sulf1 UTSW 1 12838601 missense probably damaging 1.00
R7255:Sulf1 UTSW 1 12859008 missense probably benign 0.00
R7275:Sulf1 UTSW 1 12850965 utr 3 prime probably null
R7386:Sulf1 UTSW 1 12838361 missense probably benign 0.07
R7611:Sulf1 UTSW 1 12836243 missense probably benign
R7732:Sulf1 UTSW 1 12842789 missense probably benign 0.11
R7796:Sulf1 UTSW 1 12858820 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGCAACTTTGGACCAAGCAC -3'
(R):5'- CTTTAATGCTGTAACAGGACGG -3'

Sequencing Primer
(F):5'- GCACAATGAAGTATTCCCTCTGGG -3'
(R):5'- TGCTGTAACAGGACGGATATAATACC -3'
Posted On2017-02-28