Incidental Mutation 'R5912:Cc2d2a'
ID461054
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Namecoiled-coil and C2 domain containing 2A
Synonymsb2b1035Clo, 5730509K17Rik
MMRRC Submission 044109-MU
Accession Numbers

Genbank: NM_172274; MGI: 1924487

Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock #R5912 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location43662346-43740972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 43720430 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 1043 (D1043A)
Ref Sequence ENSEMBL: ENSMUSP00000114349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048150
AA Change: D1097A

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: D1097A

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125866
AA Change: D1043A

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: D1043A

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127355
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,696 C166S possibly damaging Het
Ahnak T A 19: 9,011,903 M3517K probably damaging Het
Asap2 T C 12: 21,206,343 V214A probably damaging Het
Atp13a4 A G 16: 29,456,571 V365A probably benign Het
Bivm G T 1: 44,126,413 G8* probably null Het
Cdh2 A C 18: 16,640,450 I331S possibly damaging Het
Clip3 A C 7: 30,298,870 D247A probably benign Het
Csf3r A T 4: 126,029,960 I88F probably damaging Het
Cyp2j13 A T 4: 96,056,842 N316K probably damaging Het
Dnah12 T A 14: 26,770,008 C1133* probably null Het
Glud1 G A 14: 34,311,343 probably null Het
Gm5805 A G 15: 81,972,817 noncoding transcript Het
Gsg1l2 G T 11: 67,774,714 probably null Het
Ikzf1 C A 11: 11,748,464 S105* probably null Het
Kif18b A G 11: 102,912,991 S448P probably benign Het
Klhl31 C A 9: 77,655,730 N592K probably damaging Het
Kmt2c A G 5: 25,347,469 F1239L possibly damaging Het
Lama5 A G 2: 180,195,475 Y1014H probably damaging Het
Macf1 A C 4: 123,397,158 L3980R probably damaging Het
Magi1 A T 6: 93,708,145 S524T possibly damaging Het
Nlrp4f A T 13: 65,194,908 Y308N probably damaging Het
Olfr393 A C 11: 73,847,675 I150R possibly damaging Het
Olfr402 A T 11: 74,155,220 E22V possibly damaging Het
Rfx5 G A 3: 94,958,718 probably benign Het
Scn1b C T 7: 31,117,803 V165M probably damaging Het
Sema4c A C 1: 36,554,388 V41G possibly damaging Het
Serpini1 G T 3: 75,616,607 G174V probably benign Het
Sh2b1 T C 7: 126,471,470 E353G probably damaging Het
Slc7a6 G T 8: 106,179,657 V174L probably benign Het
Smg1 A T 7: 118,154,586 probably benign Het
Spag9 A G 11: 94,044,425 N21D probably damaging Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Sulf1 A G 1: 12,786,752 probably benign Het
Swt1 A G 1: 151,411,409 S111P probably damaging Het
Syne2 G A 12: 75,908,947 probably null Het
Tanc1 T C 2: 59,791,686 V383A possibly damaging Het
Tbc1d10b G T 7: 127,199,861 A491E probably damaging Het
Tek A G 4: 94,798,640 T132A probably damaging Het
Traf3 A G 12: 111,255,349 I290V probably benign Het
Traf5 A G 1: 191,998,069 probably benign Het
Ttn A T 2: 76,810,343 I13687N probably damaging Het
Unc5c A G 3: 141,789,006 D415G probably damaging Het
Ust A G 10: 8,298,061 Y227H probably benign Het
Vmn2r100 A G 17: 19,531,809 N705D probably damaging Het
Wnk2 T C 13: 49,060,774 E1444G probably damaging Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zbtb5 A G 4: 44,993,750 S545P probably benign Het
Zfp710 A G 7: 80,081,474 D133G probably benign Het
Zfp866 A T 8: 69,766,284 C229S probably benign Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43724380 splice site probably benign
IGL00937:Cc2d2a APN 5 43688122 critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43689003 missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43723784 missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43684185 missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43688969 missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43688237 missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43683115 missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43685248 splice site probably null
IGL02364:Cc2d2a APN 5 43735450 missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43683205 splice site probably benign
IGL02458:Cc2d2a APN 5 43718554 missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43688910 splice site probably benign
IGL02834:Cc2d2a APN 5 43714521 nonsense probably null
IGL02940:Cc2d2a APN 5 43728294 splice site probably null
IGL03003:Cc2d2a APN 5 43671266 missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43732379 missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43735457 splice site probably benign
P0028:Cc2d2a UTSW 5 43684199 missense probably benign
R0193:Cc2d2a UTSW 5 43736118 missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43737512 missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43688266 splice site probably null
R0243:Cc2d2a UTSW 5 43696638 splice site probably benign
R0317:Cc2d2a UTSW 5 43706901 critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43703294 missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43724387 splice site probably benign
R0624:Cc2d2a UTSW 5 43730029 missense probably benign
R0634:Cc2d2a UTSW 5 43681381 splice site probably benign
R1503:Cc2d2a UTSW 5 43695239 missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43722470 missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43739371 missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43723688 splice site probably null
R1715:Cc2d2a UTSW 5 43718661 missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43714531 missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43688252 missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43740828 missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43706222 missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43726373 critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43684033 splice site probably benign
R2244:Cc2d2a UTSW 5 43732433 missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43703888 missense probably benign
R2442:Cc2d2a UTSW 5 43671305 critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43735395 missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43685251 splice site probably null
R3147:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43736109 missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43718714 missense probably benign
R3870:Cc2d2a UTSW 5 43718691 nonsense probably null
R4334:Cc2d2a UTSW 5 43683134 missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43739323 missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43688221 missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43720433 missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43706213 missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43730041 missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43695176 missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43709091 missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43729907 missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43722462 missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43712418 missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43715775 missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43712426 missense probably benign
R6073:Cc2d2a UTSW 5 43729975 missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43668673 missense probably benign
R6142:Cc2d2a UTSW 5 43703198 missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43709113 missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43671235 missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43715776 missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43704074 missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43739412 missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43718677 missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43681331 missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43703215 missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43718585 missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43733929 missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43699979 nonsense probably null
R7071:Cc2d2a UTSW 5 43709113 missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43683139 missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43729990 missense probably damaging 1.00
R7908:Cc2d2a UTSW 5 43706846 missense probably benign 0.00
R7920:Cc2d2a UTSW 5 43739309 missense probably benign 0.09
R7950:Cc2d2a UTSW 5 43695296 critical splice donor site probably null
R8007:Cc2d2a UTSW 5 43706100 missense possibly damaging 0.71
R8117:Cc2d2a UTSW 5 43712439 missense probably damaging 1.00
R8123:Cc2d2a UTSW 5 43710554 missense probably benign
R8179:Cc2d2a UTSW 5 43699953 missense probably damaging 0.96
R8279:Cc2d2a UTSW 5 43736145 missense probably benign 0.01
R8293:Cc2d2a UTSW 5 43688228 missense probably damaging 0.97
R8482:Cc2d2a UTSW 5 43695239 missense probably damaging 1.00
Z1177:Cc2d2a UTSW 5 43703204 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAAGACAGTGGGCACTCTGAC -3'
(R):5'- GTAGTGGGAACTGTAGCTCC -3'

Sequencing Primer
(F):5'- AGTGGGCACTCTGACAGCTAC -3'
(R):5'- ACTGTAGCTCCAAAGATGTTTACCC -3'
Posted On2017-02-28