Incidental Mutation 'R5912:Ikzf1'
ID461066
Institutional Source Beutler Lab
Gene Symbol Ikzf1
Ensembl Gene ENSMUSG00000018654
Gene NameIKAROS family zinc finger 1
SynonymsLyF-1, 5832432G11Rik, Zfpn1a1, Ikaros
MMRRC Submission 044109-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5912 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location11685003-11772926 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 11748464 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 105 (S105*)
Ref Sequence ENSEMBL: ENSMUSP00000075992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018798] [ENSMUST00000048122] [ENSMUST00000065433] [ENSMUST00000076700] [ENSMUST00000126058]
Predicted Effect probably benign
Transcript: ENSMUST00000018798
SMART Domains Protein: ENSMUSP00000018798
Gene: ENSMUSG00000018654

DomainStartEndE-ValueType
ZnF_C2H2 58 80 8.02e-5 SMART
ZnF_C2H2 86 108 2.57e-3 SMART
ZnF_C2H2 114 137 8.22e-2 SMART
low complexity region 282 293 N/A INTRINSIC
ZnF_C2H2 371 393 7.49e0 SMART
ZnF_C2H2 399 423 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000048122
SMART Domains Protein: ENSMUSP00000046974
Gene: ENSMUSG00000018654

DomainStartEndE-ValueType
ZnF_C2H2 58 80 8.02e-5 SMART
ZnF_C2H2 86 108 2.57e-3 SMART
ZnF_C2H2 114 137 8.22e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000065433
AA Change: S125*
SMART Domains Protein: ENSMUSP00000067372
Gene: ENSMUSG00000018654
AA Change: S125*

DomainStartEndE-ValueType
ZnF_C2H2 137 159 1.43e-1 SMART
ZnF_C2H2 165 187 8.02e-5 SMART
ZnF_C2H2 193 215 2.57e-3 SMART
ZnF_C2H2 221 244 8.22e-2 SMART
low complexity region 389 400 N/A INTRINSIC
ZnF_C2H2 478 500 7.49e0 SMART
ZnF_C2H2 506 530 5.34e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000076700
AA Change: S105*
SMART Domains Protein: ENSMUSP00000075992
Gene: ENSMUSG00000018654
AA Change: S105*

DomainStartEndE-ValueType
ZnF_C2H2 117 139 1.43e-1 SMART
ZnF_C2H2 145 167 8.02e-5 SMART
ZnF_C2H2 173 195 2.57e-3 SMART
ZnF_C2H2 201 224 8.22e-2 SMART
low complexity region 369 380 N/A INTRINSIC
ZnF_C2H2 458 480 7.49e0 SMART
ZnF_C2H2 486 510 5.34e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126058
SMART Domains Protein: ENSMUSP00000119960
Gene: ENSMUSG00000018654

DomainStartEndE-ValueType
ZnF_C2H2 58 78 2.14e0 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to a family of transcription factors that are characterized by a set of four DNA-binding zinc fingers at the N-terminus and two C-terminal zinc fingers involved in protein dimerization. It is regulated by both epigenetic and transcription factors. This protein is a transcriptional regulator of hematopoietic cell development and homeostasis. In addition, it is required to confer temporal competence to retinal progenitor cells during embryogenesis, demonstrating an essential function in nervous system development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous mutants have a variety of T, B, and hematopoeitic cell maturation defects. Heterozygotes for one allele exhibit dominant negative effects and mice develop lymphoproliferative disorders. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5031439G07Rik A T 15: 84,955,696 C166S possibly damaging Het
Ahnak T A 19: 9,011,903 M3517K probably damaging Het
Asap2 T C 12: 21,206,343 V214A probably damaging Het
Atp13a4 A G 16: 29,456,571 V365A probably benign Het
Bivm G T 1: 44,126,413 G8* probably null Het
Cc2d2a A C 5: 43,720,430 D1043A probably damaging Het
Cdh2 A C 18: 16,640,450 I331S possibly damaging Het
Clip3 A C 7: 30,298,870 D247A probably benign Het
Csf3r A T 4: 126,029,960 I88F probably damaging Het
Cyp2j13 A T 4: 96,056,842 N316K probably damaging Het
Dnah12 T A 14: 26,770,008 C1133* probably null Het
Glud1 G A 14: 34,311,343 probably null Het
Gm5805 A G 15: 81,972,817 noncoding transcript Het
Gsg1l2 G T 11: 67,774,714 probably null Het
Kif18b A G 11: 102,912,991 S448P probably benign Het
Klhl31 C A 9: 77,655,730 N592K probably damaging Het
Kmt2c A G 5: 25,347,469 F1239L possibly damaging Het
Lama5 A G 2: 180,195,475 Y1014H probably damaging Het
Macf1 A C 4: 123,397,158 L3980R probably damaging Het
Magi1 A T 6: 93,708,145 S524T possibly damaging Het
Nlrp4f A T 13: 65,194,908 Y308N probably damaging Het
Olfr393 A C 11: 73,847,675 I150R possibly damaging Het
Olfr402 A T 11: 74,155,220 E22V possibly damaging Het
Rfx5 G A 3: 94,958,718 probably benign Het
Scn1b C T 7: 31,117,803 V165M probably damaging Het
Sema4c A C 1: 36,554,388 V41G possibly damaging Het
Serpini1 G T 3: 75,616,607 G174V probably benign Het
Sh2b1 T C 7: 126,471,470 E353G probably damaging Het
Slc7a6 G T 8: 106,179,657 V174L probably benign Het
Smg1 A T 7: 118,154,586 probably benign Het
Spag9 A G 11: 94,044,425 N21D probably damaging Het
Spdye4c C T 2: 128,596,074 R245* probably null Het
Sulf1 A G 1: 12,786,752 probably benign Het
Swt1 A G 1: 151,411,409 S111P probably damaging Het
Syne2 G A 12: 75,908,947 probably null Het
Tanc1 T C 2: 59,791,686 V383A possibly damaging Het
Tbc1d10b G T 7: 127,199,861 A491E probably damaging Het
Tek A G 4: 94,798,640 T132A probably damaging Het
Traf3 A G 12: 111,255,349 I290V probably benign Het
Traf5 A G 1: 191,998,069 probably benign Het
Ttn A T 2: 76,810,343 I13687N probably damaging Het
Unc5c A G 3: 141,789,006 D415G probably damaging Het
Ust A G 10: 8,298,061 Y227H probably benign Het
Vmn2r100 A G 17: 19,531,809 N705D probably damaging Het
Wnk2 T C 13: 49,060,774 E1444G probably damaging Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zbtb5 A G 4: 44,993,750 S545P probably benign Het
Zfp710 A G 7: 80,081,474 D133G probably benign Het
Zfp866 A T 8: 69,766,284 C229S probably benign Het
Other mutations in Ikzf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Ikzf1 APN 11 11768923 missense probably damaging 1.00
IGL01367:Ikzf1 APN 11 11748358 missense probably benign 0.04
IGL01823:Ikzf1 APN 11 11769091 missense possibly damaging 0.64
IGL02342:Ikzf1 APN 11 11700216 utr 5 prime probably benign
IGL02452:Ikzf1 APN 11 11748545 missense probably damaging 1.00
IGL03209:Ikzf1 APN 11 11700226 missense probably benign
IGL03236:Ikzf1 APN 11 11707848 missense probably damaging 1.00
Herrscher UTSW 11 11768961 nonsense probably null
Star_lord UTSW 11 11769448 missense probably damaging 1.00
waxwing UTSW 11 11748464 nonsense probably null
R0133:Ikzf1 UTSW 11 11741015 splice site probably null
R0417:Ikzf1 UTSW 11 11769352 missense probably benign 0.19
R0633:Ikzf1 UTSW 11 11769223 missense probably damaging 1.00
R0734:Ikzf1 UTSW 11 11758195 missense probably damaging 1.00
R1693:Ikzf1 UTSW 11 11707838 missense probably damaging 1.00
R2114:Ikzf1 UTSW 11 11769473 missense probably damaging 1.00
R2927:Ikzf1 UTSW 11 11769324 missense probably damaging 1.00
R4250:Ikzf1 UTSW 11 11754166 missense probably damaging 1.00
R5156:Ikzf1 UTSW 11 11769448 missense probably damaging 1.00
R6274:Ikzf1 UTSW 11 11768961 nonsense probably null
R7614:Ikzf1 UTSW 11 11769019 missense probably damaging 1.00
R7727:Ikzf1 UTSW 11 11748339 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTACAGGCTCAAAACTGC -3'
(R):5'- TGACAGTACATTTTGCTCCTTCAG -3'

Sequencing Primer
(F):5'- GAAGCTCCAACTGTCTATTTGATGC -3'
(R):5'- TCCTTCAGCCCCCACAGG -3'
Posted On2017-02-28