Mutagenetix > Incidental Mutations

Incidental Mutation 'R0565:Mertk'

46107

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

038756-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R0565 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128771483 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 473 (I473T)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

Predicted Effect

probably benign
Transcript: ENSMUST00000014505
AA Change: I473T

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: I473T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140221

Meta Mutation Damage Score

0.2103

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.8%
20x: 93.6%

Validation Efficiency

100% (73/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	A	T	16: 4,864,336	H1010L	probably benign	Het
A2ml1	C	A	6: 128,568,743	E474*	probably null	Het
Agtr1b	T	C	3: 20,315,674	H256R	probably damaging	Het
Amacr	C	T	15: 10,981,946	A46V	possibly damaging	Het
Cabp5	A	T	7: 13,401,335	M67L	probably damaging	Het
Caskin2	T	C	11: 115,801,016	E981G	probably damaging	Het
Ccdc88a	A	G	11: 29,461,042		probably benign	Het
Cd180	A	G	13: 102,702,874		probably benign	Het
Cemip	G	A	7: 83,964,110	H627Y	probably damaging	Het
Cep131	G	T	11: 120,073,762	H289Q	probably damaging	Het
Cep350	G	A	1: 155,961,195		probably benign	Het
Cfap52	A	T	11: 67,949,599	C169S	probably benign	Het
Cps1	A	T	1: 67,166,449	T544S	possibly damaging	Het
Cul7	T	C	17: 46,652,003	S187P	probably damaging	Het
Dhx40	C	A	11: 86,771,167	R688L	probably damaging	Het
E330034G19Rik	C	A	14: 24,306,917	Q174K	probably benign	Het
Efna5	T	C	17: 62,881,036	Y32C	probably damaging	Het
Ethe1	A	G	7: 24,607,889	H176R	probably benign	Het
Exoc3	A	G	13: 74,182,275		probably null	Het
Fam135b	T	A	15: 71,490,837	N232Y	possibly damaging	Het
Fam214b	A	T	4: 43,034,647		probably benign	Het
Fndc9	C	T	11: 46,238,157	L168F	probably damaging	Het
Fpr-rs3	G	A	17: 20,624,021	A286V	probably damaging	Het
Gm609	T	A	16: 45,444,173		probably benign	Het
Immt	T	A	6: 71,846,483		probably benign	Het
Ipo7	T	C	7: 110,049,593		probably benign	Het
Ipo8	A	T	6: 148,786,723	L747H	probably damaging	Het
Ireb2	A	T	9: 54,899,983	N610Y	probably damaging	Het
Irs2	A	G	8: 11,004,592	V1280A	probably damaging	Het
Kcnj3	T	A	2: 55,595,264	M458K	probably benign	Het
Kl	A	G	5: 150,980,944	K387R	possibly damaging	Het
L3mbtl2	C	A	15: 81,684,286		probably benign	Het
Lamb1	A	C	12: 31,298,915	I649L	probably benign	Het
Lipm	A	C	19: 34,116,506	L274F	probably benign	Het
Lrfn3	A	G	7: 30,360,791	V3A	probably benign	Het
Lrrc8c	A	C	5: 105,607,028	D223A	probably damaging	Het
Ltn1	C	A	16: 87,416,010	K554N	probably benign	Het
Mfsd12	C	A	10: 81,361,409	N245K	probably benign	Het
Mmp16	A	G	4: 17,987,705	D89G	probably damaging	Het
Myo5a	T	A	9: 75,180,112	N1083K	probably benign	Het
Ncapd3	C	T	9: 27,087,998	A1290V	probably benign	Het
Nefm	A	G	14: 68,124,621	S65P	probably damaging	Het
Nt5c2	C	T	19: 46,897,625	R220H	probably damaging	Het
Olfr1189	T	A	2: 88,592,009	D68E	probably benign	Het
Osbpl1a	A	T	18: 12,759,444	S438R	probably damaging	Het
Pcdhb5	T	C	18: 37,320,767	S67P	possibly damaging	Het
Per3	A	T	4: 151,033,952	I228N	probably damaging	Het
Pnpla7	T	G	2: 24,980,117		probably benign	Het
Ppp1r15b	G	T	1: 133,136,653		probably benign	Het
Psmd2	G	T	16: 20,660,426	L678F	probably null	Het
Ptch2	A	G	4: 117,106,143		probably benign	Het
Ranbp2	T	A	10: 58,476,336	D959E	probably benign	Het
Rph3al	C	T	11: 75,833,401		probably null	Het
Sec31b	T	A	19: 44,524,553	E499V	probably damaging	Het
Sel1l	T	C	12: 91,811,889	I667M	probably benign	Het
Sel1l	C	A	12: 91,813,945	V641L	possibly damaging	Het
Slc7a1	T	A	5: 148,352,069	I123F	probably damaging	Het
Smarca2	G	A	19: 26,681,875	R855Q	possibly damaging	Het
Sphk1	G	T	11: 116,536,358		probably benign	Het
Spink12	C	A	18: 44,104,688	S11*	probably null	Het
Sstr2	A	T	11: 113,625,619	I342F	probably benign	Het
Stxbp1	T	C	2: 32,819,848	T78A	probably benign	Het
Trim11	T	A	11: 58,990,584	S434R	probably damaging	Het
Ubr2	T	C	17: 46,955,886	E1113G	probably damaging	Het
Upb1	T	A	10: 75,428,354		probably benign	Het
Vit	T	A	17: 78,624,837	C458S	probably damaging	Het
Vmn1r58	T	C	7: 5,411,166	I22V	probably benign	Het
Vps25	T	C	11: 101,258,905		probably benign	Het
Wbp2	G	T	11: 116,082,385	D65E	possibly damaging	Het
Wdr72	A	G	9: 74,217,306	D980G	probably benign	Het
Xkr8	A	C	4: 132,730,917		probably null	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R7966:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTGTGGGCAATGTGGGTAGC -3'
(R):5'- TGCAAACCAACTGTGCCAGTGAG -3'

Sequencing Primer
(F):5'- TAGCTGTCTAGTGAGCCACC -3'
(R):5'- GGTGTCATGGGCCTTAAACC -3'

Posted On

2013-06-11