Incidental Mutation 'R5913:Ubr3'
ID461092
Institutional Source Beutler Lab
Gene Symbol Ubr3
Ensembl Gene ENSMUSG00000044308
Gene Nameubiquitin protein ligase E3 component n-recognin 3
SynonymsZfp650, 4833421P10Rik, A130030D10Rik, 1110059H15Rik
MMRRC Submission 044110-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5913 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location69897246-70024013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70021215 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1842 (Y1842C)
Ref Sequence ENSEMBL: ENSMUSP00000107870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055758] [ENSMUST00000112251]
Predicted Effect probably damaging
Transcript: ENSMUST00000055758
AA Change: Y1839C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060159
Gene: ENSMUSG00000044308
AA Change: Y1839C

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 118 188 1.6e-19 PFAM
low complexity region 339 354 N/A INTRINSIC
low complexity region 570 580 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
low complexity region 1082 1101 N/A INTRINSIC
coiled coil region 1167 1199 N/A INTRINSIC
Blast:RING 1289 1363 8e-39 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112251
AA Change: Y1842C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107870
Gene: ENSMUSG00000044308
AA Change: Y1842C

DomainStartEndE-ValueType
low complexity region 13 40 N/A INTRINSIC
low complexity region 67 88 N/A INTRINSIC
Pfam:zf-UBR 119 187 1.7e-21 PFAM
low complexity region 338 353 N/A INTRINSIC
low complexity region 569 579 N/A INTRINSIC
low complexity region 1015 1026 N/A INTRINSIC
low complexity region 1081 1100 N/A INTRINSIC
coiled coil region 1166 1198 N/A INTRINSIC
Blast:RING 1288 1362 8e-39 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150301
Meta Mutation Damage Score 0.9736 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 97% (75/77)
MGI Phenotype PHENOTYPE: Homozygous null mice obtained on a coisogenic 129S1 background die early in embryogenesis while those on a mixed 129S1/B6 background are born at a slightly reduced frequency. On a congenic C57BL/6 background, homozygotes display neonatal lethality, impaired suckling and female behavioral anosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A T 9: 110,889,705 probably null Het
Arhgef19 A T 4: 141,249,298 H457L probably benign Het
Armc3 A G 2: 19,310,047 Y856C possibly damaging Het
Bdp1 A T 13: 100,051,104 V1585D probably benign Het
Bhlhe40 T G 6: 108,665,193 M366R possibly damaging Het
Bora C T 14: 99,068,512 S439L probably benign Het
Cacnb4 G A 2: 52,434,784 probably benign Het
Carm1 T C 9: 21,587,552 S529P probably benign Het
Cd200r1 A G 16: 44,789,671 I84M possibly damaging Het
Cd209a A G 8: 3,748,742 S22P probably benign Het
Celf2 A T 2: 7,081,158 M1K probably null Het
Cep112 A G 11: 108,757,688 T783A probably damaging Het
Cep95 T C 11: 106,818,509 probably benign Het
Clip4 G A 17: 71,824,765 R366K probably benign Het
Csmd2 A G 4: 128,551,988 K3284E probably benign Het
Csn3 T A 5: 87,927,611 L12Q probably damaging Het
Ctdnep1 T C 11: 69,988,865 L39P probably damaging Het
Cxcl17 C T 7: 25,402,246 W55* probably null Het
Cyp2u1 G A 3: 131,303,211 probably benign Het
Dmgdh A T 13: 93,752,323 E823V possibly damaging Het
Dnah2 T C 11: 69,448,430 I3078V probably damaging Het
Dpp10 A C 1: 123,384,289 Y446D probably damaging Het
Eif2s3y T C Y: 1,017,365 V290A probably benign Homo
Fktn G A 4: 53,735,035 W224* probably null Het
Gm37240 T C 3: 84,967,598 probably benign Het
Gm9573 C T 17: 35,623,231 probably benign Het
Gpr3 A G 4: 133,211,178 V61A probably damaging Het
Gulo T C 14: 66,000,021 probably null Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hectd4 T A 5: 121,323,974 I968K possibly damaging Het
Hmox2 G T 16: 4,764,868 R155L probably damaging Het
Ifnlr1 C A 4: 135,705,269 Q339K probably damaging Het
Ifnlr1 A T 4: 135,705,270 Q339L probably damaging Het
Irf4 T A 13: 30,757,758 S365T probably benign Het
Klrb1a T G 6: 128,618,509 D124A probably damaging Het
Macf1 A T 4: 123,476,039 I78N probably damaging Het
Mctp1 G T 13: 76,759,825 probably null Het
Mxra8 A T 4: 155,843,303 probably null Het
Nlrp2 T A 7: 5,324,903 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
P2ry13 T C 3: 59,209,365 T331A probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Pcdhb15 A T 18: 37,474,654 Q313L probably benign Het
Pcdhga11 A G 18: 37,755,992 I18V probably benign Het
Pcdhga11 A G 18: 37,758,089 R717G probably benign Het
Pcif1 C A 2: 164,884,492 probably benign Het
Pkd1l1 T C 11: 8,863,849 T1501A probably benign Het
Plekhg2 C A 7: 28,364,602 R473L probably damaging Het
Plekhn1 T C 4: 156,222,695 Y466C probably damaging Het
Sec22c A G 9: 121,690,302 S83P possibly damaging Het
Sgcz T A 8: 37,526,271 Q224L possibly damaging Het
Slc27a1 C T 8: 71,584,263 P381L probably benign Het
Slc8a1 T A 17: 81,648,002 I536F probably damaging Het
Src T A 2: 157,466,030 probably null Het
Sybu T A 15: 44,787,621 T96S probably damaging Het
Tbc1d22a T C 15: 86,351,728 Y363H probably damaging Het
Tdrd6 T C 17: 43,628,411 E582G possibly damaging Het
Tmem131 C A 1: 36,819,128 V713L probably benign Het
Tnfsf13b T A 8: 10,006,988 L49Q probably damaging Het
Trem2 T A 17: 48,346,633 probably benign Het
Tspyl3 T A 2: 153,224,716 M201L probably benign Het
Ttl A G 2: 129,076,041 D141G probably benign Het
Ube2z A G 11: 96,061,063 V153A possibly damaging Het
Usp33 T C 3: 152,380,592 V656A probably damaging Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Vmo1 A T 11: 70,514,415 V63D probably damaging Het
Zcwpw1 T A 5: 137,800,007 D155E probably benign Het
Zeb1 T G 18: 5,766,765 S425R possibly damaging Het
Other mutations in Ubr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ubr3 APN 2 69988810 missense probably benign 0.40
IGL00985:Ubr3 APN 2 70003431 missense probably damaging 1.00
IGL01061:Ubr3 APN 2 69983225 missense probably benign 0.05
IGL01325:Ubr3 APN 2 69917097 missense possibly damaging 0.71
IGL01398:Ubr3 APN 2 69959653 missense probably damaging 1.00
IGL01484:Ubr3 APN 2 70021544 nonsense probably null
IGL01599:Ubr3 APN 2 69938178 missense probably damaging 1.00
IGL01616:Ubr3 APN 2 70020484 missense probably benign 0.14
IGL01634:Ubr3 APN 2 69973572 missense probably benign
IGL01684:Ubr3 APN 2 70016158 nonsense probably null
IGL01810:Ubr3 APN 2 70003465 splice site probably null
IGL01813:Ubr3 APN 2 69951570 missense probably benign 0.34
IGL01994:Ubr3 APN 2 70021176 missense probably damaging 1.00
IGL02188:Ubr3 APN 2 69959611 nonsense probably null
IGL02318:Ubr3 APN 2 69979397 missense probably damaging 1.00
IGL02379:Ubr3 APN 2 69948488 missense possibly damaging 0.91
IGL02635:Ubr3 APN 2 70020483 missense probably damaging 0.96
IGL02858:Ubr3 APN 2 69952859 missense probably damaging 1.00
IGL03140:Ubr3 APN 2 69970189 missense probably damaging 1.00
IGL03343:Ubr3 APN 2 69973146 splice site probably benign
Hyrax UTSW 2 69952868 missense probably benign 0.32
manatee UTSW 2 69979386 nonsense probably null
sea_cow UTSW 2 69959669 splice site probably null
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0094:Ubr3 UTSW 2 69951362 missense probably damaging 1.00
R0122:Ubr3 UTSW 2 69979412 missense probably damaging 1.00
R0243:Ubr3 UTSW 2 69951405 missense probably damaging 1.00
R0710:Ubr3 UTSW 2 69952837 missense probably damaging 1.00
R0787:Ubr3 UTSW 2 69951421 splice site probably benign
R1137:Ubr3 UTSW 2 69938315 splice site probably benign
R1191:Ubr3 UTSW 2 70021181 nonsense probably null
R1416:Ubr3 UTSW 2 69945071 missense probably damaging 1.00
R1623:Ubr3 UTSW 2 69977723 nonsense probably null
R1735:Ubr3 UTSW 2 70009129 missense probably damaging 1.00
R1789:Ubr3 UTSW 2 70016367 missense possibly damaging 0.87
R1793:Ubr3 UTSW 2 70000551 splice site probably benign
R1932:Ubr3 UTSW 2 69953476 splice site probably null
R2042:Ubr3 UTSW 2 69977774 nonsense probably null
R2085:Ubr3 UTSW 2 69953764 missense probably damaging 1.00
R2090:Ubr3 UTSW 2 69936017 missense probably damaging 1.00
R2112:Ubr3 UTSW 2 69977792 missense possibly damaging 0.73
R2173:Ubr3 UTSW 2 69897399 missense probably benign
R2215:Ubr3 UTSW 2 69979317 critical splice acceptor site probably null
R2273:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2274:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2275:Ubr3 UTSW 2 70016341 missense probably benign 0.11
R2292:Ubr3 UTSW 2 69897260 unclassified probably benign
R2447:Ubr3 UTSW 2 70003380 missense probably damaging 1.00
R2504:Ubr3 UTSW 2 69938198 missense probably damaging 0.99
R2517:Ubr3 UTSW 2 69936018 missense probably damaging 1.00
R2901:Ubr3 UTSW 2 70016192 missense possibly damaging 0.89
R3109:Ubr3 UTSW 2 69988840 missense probably damaging 1.00
R3737:Ubr3 UTSW 2 69971234 critical splice donor site probably null
R3793:Ubr3 UTSW 2 69917181 missense possibly damaging 0.95
R3821:Ubr3 UTSW 2 69993813 critical splice donor site probably null
R3918:Ubr3 UTSW 2 70016130 critical splice acceptor site probably null
R4157:Ubr3 UTSW 2 69959669 splice site probably null
R4235:Ubr3 UTSW 2 70016385 nonsense probably null
R4276:Ubr3 UTSW 2 69938387 nonsense probably null
R4544:Ubr3 UTSW 2 69956093 missense probably benign 0.18
R4678:Ubr3 UTSW 2 69935919 missense probably damaging 1.00
R4707:Ubr3 UTSW 2 69938370 intron probably benign
R4785:Ubr3 UTSW 2 69959603 missense probably damaging 1.00
R4872:Ubr3 UTSW 2 69970183 missense probably damaging 1.00
R4887:Ubr3 UTSW 2 70013131 missense probably damaging 0.99
R4920:Ubr3 UTSW 2 69952868 missense probably benign 0.32
R4989:Ubr3 UTSW 2 70020446 splice site probably benign
R5104:Ubr3 UTSW 2 69938256 missense probably damaging 0.98
R5134:Ubr3 UTSW 2 70020446 splice site probably benign
R5137:Ubr3 UTSW 2 69973335 missense probably damaging 1.00
R5174:Ubr3 UTSW 2 70009162 missense probably damaging 1.00
R5195:Ubr3 UTSW 2 69956034 missense probably benign 0.00
R5437:Ubr3 UTSW 2 69944390 missense probably damaging 1.00
R5539:Ubr3 UTSW 2 70020533 missense probably damaging 1.00
R5781:Ubr3 UTSW 2 70016244 splice site probably null
R5809:Ubr3 UTSW 2 69965511 missense possibly damaging 0.90
R5969:Ubr3 UTSW 2 69979386 nonsense probably null
R6136:Ubr3 UTSW 2 69993763 missense probably benign 0.26
R6140:Ubr3 UTSW 2 69973329 missense probably benign 0.09
R6185:Ubr3 UTSW 2 69938277 missense probably damaging 0.98
R6220:Ubr3 UTSW 2 70020475 missense probably damaging 1.00
R6258:Ubr3 UTSW 2 69982864 splice site probably null
R6319:Ubr3 UTSW 2 69973414 missense probably benign 0.00
R6322:Ubr3 UTSW 2 69956085 nonsense probably null
R6470:Ubr3 UTSW 2 69965460 missense probably benign 0.02
R6477:Ubr3 UTSW 2 69979429 nonsense probably null
R6702:Ubr3 UTSW 2 69956049 missense probably benign 0.23
R6709:Ubr3 UTSW 2 70013092 missense probably damaging 1.00
R6803:Ubr3 UTSW 2 69936024 critical splice donor site probably null
R6806:Ubr3 UTSW 2 69955964 splice site probably benign
R6834:Ubr3 UTSW 2 70000481 missense possibly damaging 0.63
R6841:Ubr3 UTSW 2 70020625 missense probably damaging 1.00
R6847:Ubr3 UTSW 2 69983128 missense probably damaging 1.00
R6889:Ubr3 UTSW 2 69944300 missense possibly damaging 0.70
R7065:Ubr3 UTSW 2 69953705 missense probably damaging 1.00
R7102:Ubr3 UTSW 2 69897822 missense probably damaging 1.00
R7156:Ubr3 UTSW 2 70021623 missense probably damaging 1.00
R7209:Ubr3 UTSW 2 70016134 missense probably benign 0.01
R7273:Ubr3 UTSW 2 69979333 missense probably damaging 0.97
R7314:Ubr3 UTSW 2 69991600 missense probably damaging 1.00
R7422:Ubr3 UTSW 2 69953542 critical splice donor site probably null
R7584:Ubr3 UTSW 2 69991503 missense probably damaging 1.00
R7588:Ubr3 UTSW 2 69971169 missense probably damaging 1.00
R7597:Ubr3 UTSW 2 69973468 missense possibly damaging 0.69
R7697:Ubr3 UTSW 2 69897686 missense probably damaging 1.00
R7737:Ubr3 UTSW 2 69991566 missense probably benign 0.07
R7743:Ubr3 UTSW 2 69944449 missense probably benign 0.28
R7946:Ubr3 UTSW 2 69951395 missense possibly damaging 0.95
R7991:Ubr3 UTSW 2 69952856 missense probably damaging 1.00
R8071:Ubr3 UTSW 2 69988876 missense probably damaging 0.99
R8136:Ubr3 UTSW 2 70021179 missense probably damaging 1.00
R8296:Ubr3 UTSW 2 69954362 missense probably null 1.00
R8313:Ubr3 UTSW 2 69945134 missense probably damaging 0.99
Z1088:Ubr3 UTSW 2 69922367 missense probably benign 0.00
Z1177:Ubr3 UTSW 2 69897461 missense probably benign 0.17
Z1177:Ubr3 UTSW 2 69897666 missense probably damaging 1.00
Z1177:Ubr3 UTSW 2 69973206 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTGTGCTCGCTTCAACGC -3'
(R):5'- AGGCTTACCCATGCATTCC -3'

Sequencing Primer
(F):5'- AACGCTTCTTCATTTATTCATGAGC -3'
(R):5'- TTCTTCAACACACTATGGCAAAG -3'
Posted On2017-02-28