Incidental Mutation 'R5913:Src'
ID461096
Institutional Source Beutler Lab
Gene Symbol Src
Ensembl Gene ENSMUSG00000027646
Gene NameRous sarcoma oncogene
Synonymspp60c-src
MMRRC Submission 044110-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R5913 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location157418444-157471862 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 157466030 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029175] [ENSMUST00000029175] [ENSMUST00000092576] [ENSMUST00000092576] [ENSMUST00000109529] [ENSMUST00000109529] [ENSMUST00000109531] [ENSMUST00000109533]
Predicted Effect probably null
Transcript: ENSMUST00000029175
SMART Domains Protein: ENSMUSP00000029175
Gene: ENSMUSG00000027646

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000029175
SMART Domains Protein: ENSMUSP00000029175
Gene: ENSMUSG00000027646

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000092576
SMART Domains Protein: ENSMUSP00000090237
Gene: ENSMUSG00000027646

DomainStartEndE-ValueType
SH3 86 149 1.2e-19 SMART
SH2 154 244 6.56e-37 SMART
TyrKc 275 524 2.97e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000092576
SMART Domains Protein: ENSMUSP00000090237
Gene: ENSMUSG00000027646

DomainStartEndE-ValueType
SH3 86 149 1.2e-19 SMART
SH2 154 244 6.56e-37 SMART
TyrKc 275 524 2.97e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109529
SMART Domains Protein: ENSMUSP00000105155
Gene: ENSMUSG00000027646

DomainStartEndE-ValueType
SH3 86 149 1.2e-19 SMART
SH2 154 244 6.56e-37 SMART
TyrKc 275 524 2.97e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109529
SMART Domains Protein: ENSMUSP00000105155
Gene: ENSMUSG00000027646

DomainStartEndE-ValueType
SH3 86 149 1.2e-19 SMART
SH2 154 244 6.56e-37 SMART
TyrKc 275 524 2.97e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109531
SMART Domains Protein: ENSMUSP00000105157
Gene: ENSMUSG00000027646

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Predicted Effect probably null
Transcript: ENSMUST00000109533
SMART Domains Protein: ENSMUSP00000105159
Gene: ENSMUSG00000027646

DomainStartEndE-ValueType
SH3 86 143 2.48e-21 SMART
SH2 148 238 6.56e-37 SMART
TyrKc 269 518 2.97e-131 SMART
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is highly similar to the v-src gene of Rous sarcoma virus. This proto-oncogene may play a role in the regulation of embryonic development and cell growth. The protein encoded by this gene is a tyrosine-protein kinase whose activity can be inhibited by phosphorylation by c-SRC kinase. Mutations in this gene could be involved in the malignant progression of colon cancer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit growth retardation, failure of tooth eruption, osteopetrosis with lack of secondary bone resorption, and lethality at 3-4 weeks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A T 9: 110,889,705 probably null Het
Arhgef19 A T 4: 141,249,298 H457L probably benign Het
Armc3 A G 2: 19,310,047 Y856C possibly damaging Het
Bdp1 A T 13: 100,051,104 V1585D probably benign Het
Bhlhe40 T G 6: 108,665,193 M366R possibly damaging Het
Bora C T 14: 99,068,512 S439L probably benign Het
Cacnb4 G A 2: 52,434,784 probably benign Het
Carm1 T C 9: 21,587,552 S529P probably benign Het
Cd200r1 A G 16: 44,789,671 I84M possibly damaging Het
Cd209a A G 8: 3,748,742 S22P probably benign Het
Celf2 A T 2: 7,081,158 M1K probably null Het
Cep112 A G 11: 108,757,688 T783A probably damaging Het
Cep95 T C 11: 106,818,509 probably benign Het
Clip4 G A 17: 71,824,765 R366K probably benign Het
Csmd2 A G 4: 128,551,988 K3284E probably benign Het
Csn3 T A 5: 87,927,611 L12Q probably damaging Het
Ctdnep1 T C 11: 69,988,865 L39P probably damaging Het
Cxcl17 C T 7: 25,402,246 W55* probably null Het
Cyp2u1 G A 3: 131,303,211 probably benign Het
Dmgdh A T 13: 93,752,323 E823V possibly damaging Het
Dnah2 T C 11: 69,448,430 I3078V probably damaging Het
Dpp10 A C 1: 123,384,289 Y446D probably damaging Het
Eif2s3y T C Y: 1,017,365 V290A probably benign Homo
Fktn G A 4: 53,735,035 W224* probably null Het
Gm37240 T C 3: 84,967,598 probably benign Het
Gm9573 C T 17: 35,623,231 probably benign Het
Gpr3 A G 4: 133,211,178 V61A probably damaging Het
Gulo T C 14: 66,000,021 probably null Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hectd4 T A 5: 121,323,974 I968K possibly damaging Het
Hmox2 G T 16: 4,764,868 R155L probably damaging Het
Ifnlr1 C A 4: 135,705,269 Q339K probably damaging Het
Ifnlr1 A T 4: 135,705,270 Q339L probably damaging Het
Irf4 T A 13: 30,757,758 S365T probably benign Het
Klrb1a T G 6: 128,618,509 D124A probably damaging Het
Macf1 A T 4: 123,476,039 I78N probably damaging Het
Mctp1 G T 13: 76,759,825 probably null Het
Mxra8 A T 4: 155,843,303 probably null Het
Nlrp2 T A 7: 5,324,903 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
P2ry13 T C 3: 59,209,365 T331A probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Pcdhb15 A T 18: 37,474,654 Q313L probably benign Het
Pcdhga11 A G 18: 37,755,992 I18V probably benign Het
Pcdhga11 A G 18: 37,758,089 R717G probably benign Het
Pcif1 C A 2: 164,884,492 probably benign Het
Pkd1l1 T C 11: 8,863,849 T1501A probably benign Het
Plekhg2 C A 7: 28,364,602 R473L probably damaging Het
Plekhn1 T C 4: 156,222,695 Y466C probably damaging Het
Sec22c A G 9: 121,690,302 S83P possibly damaging Het
Sgcz T A 8: 37,526,271 Q224L possibly damaging Het
Slc27a1 C T 8: 71,584,263 P381L probably benign Het
Slc8a1 T A 17: 81,648,002 I536F probably damaging Het
Sybu T A 15: 44,787,621 T96S probably damaging Het
Tbc1d22a T C 15: 86,351,728 Y363H probably damaging Het
Tdrd6 T C 17: 43,628,411 E582G possibly damaging Het
Tmem131 C A 1: 36,819,128 V713L probably benign Het
Tnfsf13b T A 8: 10,006,988 L49Q probably damaging Het
Trem2 T A 17: 48,346,633 probably benign Het
Tspyl3 T A 2: 153,224,716 M201L probably benign Het
Ttl A G 2: 129,076,041 D141G probably benign Het
Ube2z A G 11: 96,061,063 V153A possibly damaging Het
Ubr3 A G 2: 70,021,215 Y1842C probably damaging Het
Usp33 T C 3: 152,380,592 V656A probably damaging Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Vmo1 A T 11: 70,514,415 V63D probably damaging Het
Zcwpw1 T A 5: 137,800,007 D155E probably benign Het
Zeb1 T G 18: 5,766,765 S425R possibly damaging Het
Other mutations in Src
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Src APN 2 157469503 missense probably damaging 1.00
IGL01320:Src APN 2 157469503 missense probably damaging 1.00
IGL01323:Src APN 2 157469503 missense probably damaging 1.00
IGL01452:Src APN 2 157462983 missense probably damaging 1.00
IGL02618:Src APN 2 157464778 nonsense probably null
R0605:Src UTSW 2 157469921 missense probably damaging 1.00
R1457:Src UTSW 2 157469212 missense probably damaging 1.00
R1471:Src UTSW 2 157457187 nonsense probably null
R1694:Src UTSW 2 157469755 missense possibly damaging 0.95
R2040:Src UTSW 2 157457110 missense probably benign 0.02
R2209:Src UTSW 2 157462790 missense probably benign 0.16
R4112:Src UTSW 2 157463026 missense probably damaging 1.00
R4414:Src UTSW 2 157464653 missense probably damaging 1.00
R4581:Src UTSW 2 157463038 missense probably damaging 0.98
R4661:Src UTSW 2 157469932 missense probably damaging 1.00
R4781:Src UTSW 2 157467485 missense possibly damaging 0.71
R5504:Src UTSW 2 157464721 missense probably damaging 1.00
R6166:Src UTSW 2 157468522 missense probably damaging 0.99
R6336:Src UTSW 2 157457155 missense probably benign 0.04
R7707:Src UTSW 2 157464658 missense probably damaging 1.00
R7709:Src UTSW 2 157457244 missense probably benign 0.00
Z1176:Src UTSW 2 157467539 missense not run
Predicted Primers PCR Primer
(F):5'- CATAGAGCCGTACACACAGG -3'
(R):5'- ATGCGGGGTTCAAAGTGTC -3'

Sequencing Primer
(F):5'- AAGCCAGCTTGCTGTGG -3'
(R):5'- CGGGGTTCAAAGTGTCACAGG -3'
Posted On2017-02-28