Incidental Mutation 'R5913:Csmd2'
ID461103
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 044110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R5913 (G1)
Quality Score166
Status Validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128551988 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 3284 (K3284E)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139561
Predicted Effect probably benign
Transcript: ENSMUST00000184063
AA Change: K3284E

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000221199
Meta Mutation Damage Score 0.1763 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A T 9: 110,889,705 probably null Het
Arhgef19 A T 4: 141,249,298 H457L probably benign Het
Armc3 A G 2: 19,310,047 Y856C possibly damaging Het
Bdp1 A T 13: 100,051,104 V1585D probably benign Het
Bhlhe40 T G 6: 108,665,193 M366R possibly damaging Het
Bora C T 14: 99,068,512 S439L probably benign Het
Cacnb4 G A 2: 52,434,784 probably benign Het
Carm1 T C 9: 21,587,552 S529P probably benign Het
Cd200r1 A G 16: 44,789,671 I84M possibly damaging Het
Cd209a A G 8: 3,748,742 S22P probably benign Het
Celf2 A T 2: 7,081,158 M1K probably null Het
Cep112 A G 11: 108,757,688 T783A probably damaging Het
Cep95 T C 11: 106,818,509 probably benign Het
Clip4 G A 17: 71,824,765 R366K probably benign Het
Csn3 T A 5: 87,927,611 L12Q probably damaging Het
Ctdnep1 T C 11: 69,988,865 L39P probably damaging Het
Cxcl17 C T 7: 25,402,246 W55* probably null Het
Cyp2u1 G A 3: 131,303,211 probably benign Het
Dmgdh A T 13: 93,752,323 E823V possibly damaging Het
Dnah2 T C 11: 69,448,430 I3078V probably damaging Het
Dpp10 A C 1: 123,384,289 Y446D probably damaging Het
Eif2s3y T C Y: 1,017,365 V290A probably benign Homo
Fktn G A 4: 53,735,035 W224* probably null Het
Gm37240 T C 3: 84,967,598 probably benign Het
Gm9573 C T 17: 35,623,231 probably benign Het
Gpr3 A G 4: 133,211,178 V61A probably damaging Het
Gulo T C 14: 66,000,021 probably null Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hectd4 T A 5: 121,323,974 I968K possibly damaging Het
Hmox2 G T 16: 4,764,868 R155L probably damaging Het
Ifnlr1 C A 4: 135,705,269 Q339K probably damaging Het
Ifnlr1 A T 4: 135,705,270 Q339L probably damaging Het
Irf4 T A 13: 30,757,758 S365T probably benign Het
Klrb1a T G 6: 128,618,509 D124A probably damaging Het
Macf1 A T 4: 123,476,039 I78N probably damaging Het
Mctp1 G T 13: 76,759,825 probably null Het
Mxra8 A T 4: 155,843,303 probably null Het
Nlrp2 T A 7: 5,324,903 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
P2ry13 T C 3: 59,209,365 T331A probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Pcdhb15 A T 18: 37,474,654 Q313L probably benign Het
Pcdhga11 A G 18: 37,755,992 I18V probably benign Het
Pcdhga11 A G 18: 37,758,089 R717G probably benign Het
Pcif1 C A 2: 164,884,492 probably benign Het
Pkd1l1 T C 11: 8,863,849 T1501A probably benign Het
Plekhg2 C A 7: 28,364,602 R473L probably damaging Het
Plekhn1 T C 4: 156,222,695 Y466C probably damaging Het
Sec22c A G 9: 121,690,302 S83P possibly damaging Het
Sgcz T A 8: 37,526,271 Q224L possibly damaging Het
Slc27a1 C T 8: 71,584,263 P381L probably benign Het
Slc8a1 T A 17: 81,648,002 I536F probably damaging Het
Src T A 2: 157,466,030 probably null Het
Sybu T A 15: 44,787,621 T96S probably damaging Het
Tbc1d22a T C 15: 86,351,728 Y363H probably damaging Het
Tdrd6 T C 17: 43,628,411 E582G possibly damaging Het
Tmem131 C A 1: 36,819,128 V713L probably benign Het
Tnfsf13b T A 8: 10,006,988 L49Q probably damaging Het
Trem2 T A 17: 48,346,633 probably benign Het
Tspyl3 T A 2: 153,224,716 M201L probably benign Het
Ttl A G 2: 129,076,041 D141G probably benign Het
Ube2z A G 11: 96,061,063 V153A possibly damaging Het
Ubr3 A G 2: 70,021,215 Y1842C probably damaging Het
Usp33 T C 3: 152,380,592 V656A probably damaging Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Vmo1 A T 11: 70,514,415 V63D probably damaging Het
Zcwpw1 T A 5: 137,800,007 D155E probably benign Het
Zeb1 T G 18: 5,766,765 S425R possibly damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 splice site probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5410:Csmd2 UTSW 4 128548819 missense probably benign
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 splice site probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- GCATCCTTTCAGTAGTCCCAAAG -3'
(R):5'- CATCTGTGATGCCCCAAGAG -3'

Sequencing Primer
(F):5'- GGACCAATAGGACTCAGCCAG -3'
(R):5'- GTACTATAGAGAGCCCAACACTGGTC -3'
Posted On2017-02-28