Incidental Mutation 'R5913:Cxcl17'
ID461118
Institutional Source Beutler Lab
Gene Symbol Cxcl17
Ensembl Gene ENSMUSG00000060188
Gene Namechemokine (C-X-C motif) ligand 17
Synonyms
MMRRC Submission 044110-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5913 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location25400053-25412886 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 25402246 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 55 (W55*)
Ref Sequence ENSEMBL: ENSMUSP00000144096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074040] [ENSMUST00000105177] [ENSMUST00000149349] [ENSMUST00000200880]
Predicted Effect probably null
Transcript: ENSMUST00000074040
AA Change: W55*
SMART Domains Protein: ENSMUSP00000073687
Gene: ENSMUSG00000060188
AA Change: W55*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CXCL17 23 126 2.8e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105177
SMART Domains Protein: ENSMUSP00000100811
Gene: ENSMUSG00000003123

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149349
SMART Domains Protein: ENSMUSP00000123485
Gene: ENSMUSG00000003123

DomainStartEndE-ValueType
low complexity region 74 90 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 250 261 N/A INTRINSIC
Pfam:HSL_N 319 627 1.2e-116 PFAM
Pfam:DUF2424 616 774 1.2e-8 PFAM
Pfam:Abhydrolase_3 658 817 1.9e-34 PFAM
low complexity region 881 896 N/A INTRINSIC
Pfam:Abhydrolase_3 951 1041 2.3e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200880
AA Change: W55*
SMART Domains Protein: ENSMUSP00000144096
Gene: ENSMUSG00000060188
AA Change: W55*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CXCL17 23 111 2.8e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206436
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mucosal chemokine that attracts immature dendritic cells and blood monocytes to the lungs. The encoded protein also promotes tumorigenesis through an angiogenic activity. Finally, this protein exhibits strong antimicrobial activity against E. coli, S. aureus, Salmonella, P. aeruginosa, and C. albicans. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A T 9: 110,889,705 probably null Het
Arhgef19 A T 4: 141,249,298 H457L probably benign Het
Armc3 A G 2: 19,310,047 Y856C possibly damaging Het
Bdp1 A T 13: 100,051,104 V1585D probably benign Het
Bhlhe40 T G 6: 108,665,193 M366R possibly damaging Het
Bora C T 14: 99,068,512 S439L probably benign Het
Cacnb4 G A 2: 52,434,784 probably benign Het
Carm1 T C 9: 21,587,552 S529P probably benign Het
Cd200r1 A G 16: 44,789,671 I84M possibly damaging Het
Cd209a A G 8: 3,748,742 S22P probably benign Het
Celf2 A T 2: 7,081,158 M1K probably null Het
Cep112 A G 11: 108,757,688 T783A probably damaging Het
Cep95 T C 11: 106,818,509 probably benign Het
Clip4 G A 17: 71,824,765 R366K probably benign Het
Csmd2 A G 4: 128,551,988 K3284E probably benign Het
Csn3 T A 5: 87,927,611 L12Q probably damaging Het
Ctdnep1 T C 11: 69,988,865 L39P probably damaging Het
Cyp2u1 G A 3: 131,303,211 probably benign Het
Dmgdh A T 13: 93,752,323 E823V possibly damaging Het
Dnah2 T C 11: 69,448,430 I3078V probably damaging Het
Dpp10 A C 1: 123,384,289 Y446D probably damaging Het
Eif2s3y T C Y: 1,017,365 V290A probably benign Homo
Fktn G A 4: 53,735,035 W224* probably null Het
Gm37240 T C 3: 84,967,598 probably benign Het
Gm9573 C T 17: 35,623,231 probably benign Het
Gpr3 A G 4: 133,211,178 V61A probably damaging Het
Gulo T C 14: 66,000,021 probably null Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hectd4 T A 5: 121,323,974 I968K possibly damaging Het
Hmox2 G T 16: 4,764,868 R155L probably damaging Het
Ifnlr1 C A 4: 135,705,269 Q339K probably damaging Het
Ifnlr1 A T 4: 135,705,270 Q339L probably damaging Het
Irf4 T A 13: 30,757,758 S365T probably benign Het
Klrb1a T G 6: 128,618,509 D124A probably damaging Het
Macf1 A T 4: 123,476,039 I78N probably damaging Het
Mctp1 G T 13: 76,759,825 probably null Het
Mxra8 A T 4: 155,843,303 probably null Het
Nlrp2 T A 7: 5,324,903 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
P2ry13 T C 3: 59,209,365 T331A probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Pcdhb15 A T 18: 37,474,654 Q313L probably benign Het
Pcdhga11 A G 18: 37,755,992 I18V probably benign Het
Pcdhga11 A G 18: 37,758,089 R717G probably benign Het
Pcif1 C A 2: 164,884,492 probably benign Het
Pkd1l1 T C 11: 8,863,849 T1501A probably benign Het
Plekhg2 C A 7: 28,364,602 R473L probably damaging Het
Plekhn1 T C 4: 156,222,695 Y466C probably damaging Het
Sec22c A G 9: 121,690,302 S83P possibly damaging Het
Sgcz T A 8: 37,526,271 Q224L possibly damaging Het
Slc27a1 C T 8: 71,584,263 P381L probably benign Het
Slc8a1 T A 17: 81,648,002 I536F probably damaging Het
Src T A 2: 157,466,030 probably null Het
Sybu T A 15: 44,787,621 T96S probably damaging Het
Tbc1d22a T C 15: 86,351,728 Y363H probably damaging Het
Tdrd6 T C 17: 43,628,411 E582G possibly damaging Het
Tmem131 C A 1: 36,819,128 V713L probably benign Het
Tnfsf13b T A 8: 10,006,988 L49Q probably damaging Het
Trem2 T A 17: 48,346,633 probably benign Het
Tspyl3 T A 2: 153,224,716 M201L probably benign Het
Ttl A G 2: 129,076,041 D141G probably benign Het
Ube2z A G 11: 96,061,063 V153A possibly damaging Het
Ubr3 A G 2: 70,021,215 Y1842C probably damaging Het
Usp33 T C 3: 152,380,592 V656A probably damaging Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Vmo1 A T 11: 70,514,415 V63D probably damaging Het
Zcwpw1 T A 5: 137,800,007 D155E probably benign Het
Zeb1 T G 18: 5,766,765 S425R possibly damaging Het
Other mutations in Cxcl17
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1527:Cxcl17 UTSW 7 25402211 missense possibly damaging 0.51
R3772:Cxcl17 UTSW 7 25400329 utr 3 prime probably benign
R7227:Cxcl17 UTSW 7 25402894 missense probably damaging 0.96
R7673:Cxcl17 UTSW 7 25402868 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTTGATGCAGCCTTACCTCC -3'
(R):5'- ATCCCAATGCGCCCTTCTAAAG -3'

Sequencing Primer
(F):5'- AGCCTTACCTCCACCCCTAGTG -3'
(R):5'- TGCGCCCTTCTAAAGCAAATC -3'
Posted On2017-02-28