Incidental Mutation 'R5913:Sec22c'
ID461127
Institutional Source Beutler Lab
Gene Symbol Sec22c
Ensembl Gene ENSMUSG00000061536
Gene NameSEC22 homolog C, vesicle trafficking protein
SynonymsSec22l3, 5930407I15Rik
MMRRC Submission 044110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5913 (G1)
Quality Score211
Status Validated
Chromosome9
Chromosomal Location121680045-121705490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121690302 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 83 (S83P)
Ref Sequence ENSEMBL: ENSMUSP00000149594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078547] [ENSMUST00000111560] [ENSMUST00000139193] [ENSMUST00000215056]
Predicted Effect probably benign
Transcript: ENSMUST00000078547
AA Change: S154P

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077628
Gene: ENSMUSG00000061536
AA Change: S154P

DomainStartEndE-ValueType
Longin 36 118 1.87e-19 SMART
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 224 243 N/A INTRINSIC
transmembrane domain 250 269 N/A INTRINSIC
transmembrane domain 273 290 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111560
AA Change: S154P

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107185
Gene: ENSMUSG00000061536
AA Change: S154P

DomainStartEndE-ValueType
Longin 36 118 1.87e-19 SMART
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 224 243 N/A INTRINSIC
transmembrane domain 250 269 N/A INTRINSIC
transmembrane domain 273 290 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132733
Predicted Effect probably benign
Transcript: ENSMUST00000139193
SMART Domains Protein: ENSMUSP00000114270
Gene: ENSMUSG00000061536

DomainStartEndE-ValueType
SCOP:d1ifqa_ 4 60 5e-12 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000215056
AA Change: S83P

PolyPhen 2 Score 0.846 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SEC22 family of vesicle trafficking proteins. The encoded protein is localized to the endoplasmic reticulum and may play a role in the early stages of ER-Golgi protein trafficking. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A T 9: 110,889,705 probably null Het
Arhgef19 A T 4: 141,249,298 H457L probably benign Het
Armc3 A G 2: 19,310,047 Y856C possibly damaging Het
Bdp1 A T 13: 100,051,104 V1585D probably benign Het
Bhlhe40 T G 6: 108,665,193 M366R possibly damaging Het
Bora C T 14: 99,068,512 S439L probably benign Het
Cacnb4 G A 2: 52,434,784 probably benign Het
Carm1 T C 9: 21,587,552 S529P probably benign Het
Cd200r1 A G 16: 44,789,671 I84M possibly damaging Het
Cd209a A G 8: 3,748,742 S22P probably benign Het
Celf2 A T 2: 7,081,158 M1K probably null Het
Cep112 A G 11: 108,757,688 T783A probably damaging Het
Cep95 T C 11: 106,818,509 probably benign Het
Clip4 G A 17: 71,824,765 R366K probably benign Het
Csmd2 A G 4: 128,551,988 K3284E probably benign Het
Csn3 T A 5: 87,927,611 L12Q probably damaging Het
Ctdnep1 T C 11: 69,988,865 L39P probably damaging Het
Cxcl17 C T 7: 25,402,246 W55* probably null Het
Cyp2u1 G A 3: 131,303,211 probably benign Het
Dmgdh A T 13: 93,752,323 E823V possibly damaging Het
Dnah2 T C 11: 69,448,430 I3078V probably damaging Het
Dpp10 A C 1: 123,384,289 Y446D probably damaging Het
Eif2s3y T C Y: 1,017,365 V290A probably benign Homo
Fktn G A 4: 53,735,035 W224* probably null Het
Gm37240 T C 3: 84,967,598 probably benign Het
Gm9573 C T 17: 35,623,231 probably benign Het
Gpr3 A G 4: 133,211,178 V61A probably damaging Het
Gulo T C 14: 66,000,021 probably null Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hectd4 T A 5: 121,323,974 I968K possibly damaging Het
Hmox2 G T 16: 4,764,868 R155L probably damaging Het
Ifnlr1 C A 4: 135,705,269 Q339K probably damaging Het
Ifnlr1 A T 4: 135,705,270 Q339L probably damaging Het
Irf4 T A 13: 30,757,758 S365T probably benign Het
Klrb1a T G 6: 128,618,509 D124A probably damaging Het
Macf1 A T 4: 123,476,039 I78N probably damaging Het
Mctp1 G T 13: 76,759,825 probably null Het
Mxra8 A T 4: 155,843,303 probably null Het
Nlrp2 T A 7: 5,324,903 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
P2ry13 T C 3: 59,209,365 T331A probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Pcdhb15 A T 18: 37,474,654 Q313L probably benign Het
Pcdhga11 A G 18: 37,755,992 I18V probably benign Het
Pcdhga11 A G 18: 37,758,089 R717G probably benign Het
Pcif1 C A 2: 164,884,492 probably benign Het
Pkd1l1 T C 11: 8,863,849 T1501A probably benign Het
Plekhg2 C A 7: 28,364,602 R473L probably damaging Het
Plekhn1 T C 4: 156,222,695 Y466C probably damaging Het
Sgcz T A 8: 37,526,271 Q224L possibly damaging Het
Slc27a1 C T 8: 71,584,263 P381L probably benign Het
Slc8a1 T A 17: 81,648,002 I536F probably damaging Het
Src T A 2: 157,466,030 probably null Het
Sybu T A 15: 44,787,621 T96S probably damaging Het
Tbc1d22a T C 15: 86,351,728 Y363H probably damaging Het
Tdrd6 T C 17: 43,628,411 E582G possibly damaging Het
Tmem131 C A 1: 36,819,128 V713L probably benign Het
Tnfsf13b T A 8: 10,006,988 L49Q probably damaging Het
Trem2 T A 17: 48,346,633 probably benign Het
Tspyl3 T A 2: 153,224,716 M201L probably benign Het
Ttl A G 2: 129,076,041 D141G probably benign Het
Ube2z A G 11: 96,061,063 V153A possibly damaging Het
Ubr3 A G 2: 70,021,215 Y1842C probably damaging Het
Usp33 T C 3: 152,380,592 V656A probably damaging Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Vmo1 A T 11: 70,514,415 V63D probably damaging Het
Zcwpw1 T A 5: 137,800,007 D155E probably benign Het
Zeb1 T G 18: 5,766,765 S425R possibly damaging Het
Other mutations in Sec22c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02152:Sec22c APN 9 121684779 missense probably benign 0.00
IGL02563:Sec22c APN 9 121684650 utr 3 prime probably benign
IGL02582:Sec22c APN 9 121685564 missense probably benign 0.07
IGL03333:Sec22c APN 9 121688218 missense probably damaging 1.00
R0071:Sec22c UTSW 9 121692913 missense probably damaging 1.00
R0071:Sec22c UTSW 9 121692913 missense probably damaging 1.00
R1972:Sec22c UTSW 9 121688254 missense possibly damaging 0.88
R4604:Sec22c UTSW 9 121695642 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTTTACAACAAACCGCCTG -3'
(R):5'- CCTGACCTCCGATAACTGACTC -3'

Sequencing Primer
(F):5'- TGGAAATGGGGCCCATCCAG -3'
(R):5'- CGATAACTGACTCTGTTCGGAATCTG -3'
Posted On2017-02-28