Incidental Mutation 'R5913:Cep95'
ID461134
Institutional Source Beutler Lab
Gene Symbol Cep95
Ensembl Gene ENSMUSG00000018372
Gene Namecentrosomal protein 95
SynonymsF630025I20Rik, Ccdc45, 4732496G21Rik
MMRRC Submission 044110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R5913 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106789252-106819930 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 106818509 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018516] [ENSMUST00000092517] [ENSMUST00000103067] [ENSMUST00000103068] [ENSMUST00000124898] [ENSMUST00000139297] [ENSMUST00000167787]
Predicted Effect probably benign
Transcript: ENSMUST00000018516
SMART Domains Protein: ENSMUSP00000018516
Gene: ENSMUSG00000018372

DomainStartEndE-ValueType
low complexity region 389 407 N/A INTRINSIC
coiled coil region 584 633 N/A INTRINSIC
coiled coil region 701 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092517
SMART Domains Protein: ENSMUSP00000090177
Gene: ENSMUSG00000018363

DomainStartEndE-ValueType
C2 13 116 1.51e-15 SMART
WW 158 190 1.96e-11 SMART
WW 252 284 2.47e-8 SMART
WW 298 330 4.97e-13 SMART
low complexity region 341 351 N/A INTRINSIC
HECTc 412 748 1.75e-165 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103067
SMART Domains Protein: ENSMUSP00000099356
Gene: ENSMUSG00000018363

DomainStartEndE-ValueType
C2 13 103 1e-6 SMART
WW 145 177 1.96e-11 SMART
WW 239 271 2.47e-8 SMART
WW 285 317 4.97e-13 SMART
low complexity region 328 338 N/A INTRINSIC
HECTc 399 735 1.75e-165 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103068
SMART Domains Protein: ENSMUSP00000099357
Gene: ENSMUSG00000018372

DomainStartEndE-ValueType
low complexity region 346 364 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
coiled coil region 658 750 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124898
SMART Domains Protein: ENSMUSP00000122454
Gene: ENSMUSG00000018372

DomainStartEndE-ValueType
coiled coil region 7 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133581
Predicted Effect probably benign
Transcript: ENSMUST00000139297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149279
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151282
Predicted Effect probably benign
Transcript: ENSMUST00000167787
SMART Domains Protein: ENSMUSP00000129269
Gene: ENSMUSG00000018363

DomainStartEndE-ValueType
C2 13 116 1.51e-15 SMART
WW 158 190 1.96e-11 SMART
WW 252 284 2.47e-8 SMART
WW 298 330 4.97e-13 SMART
low complexity region 341 351 N/A INTRINSIC
HECTc 412 748 1.75e-165 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A T 9: 110,889,705 probably null Het
Arhgef19 A T 4: 141,249,298 H457L probably benign Het
Armc3 A G 2: 19,310,047 Y856C possibly damaging Het
Bdp1 A T 13: 100,051,104 V1585D probably benign Het
Bhlhe40 T G 6: 108,665,193 M366R possibly damaging Het
Bora C T 14: 99,068,512 S439L probably benign Het
Cacnb4 G A 2: 52,434,784 probably benign Het
Carm1 T C 9: 21,587,552 S529P probably benign Het
Cd200r1 A G 16: 44,789,671 I84M possibly damaging Het
Cd209a A G 8: 3,748,742 S22P probably benign Het
Celf2 A T 2: 7,081,158 M1K probably null Het
Cep112 A G 11: 108,757,688 T783A probably damaging Het
Clip4 G A 17: 71,824,765 R366K probably benign Het
Csmd2 A G 4: 128,551,988 K3284E probably benign Het
Csn3 T A 5: 87,927,611 L12Q probably damaging Het
Ctdnep1 T C 11: 69,988,865 L39P probably damaging Het
Cxcl17 C T 7: 25,402,246 W55* probably null Het
Cyp2u1 G A 3: 131,303,211 probably benign Het
Dmgdh A T 13: 93,752,323 E823V possibly damaging Het
Dnah2 T C 11: 69,448,430 I3078V probably damaging Het
Dpp10 A C 1: 123,384,289 Y446D probably damaging Het
Eif2s3y T C Y: 1,017,365 V290A probably benign Homo
Fktn G A 4: 53,735,035 W224* probably null Het
Gm37240 T C 3: 84,967,598 probably benign Het
Gm9573 C T 17: 35,623,231 probably benign Het
Gpr3 A G 4: 133,211,178 V61A probably damaging Het
Gulo T C 14: 66,000,021 probably null Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hectd4 T A 5: 121,323,974 I968K possibly damaging Het
Hmox2 G T 16: 4,764,868 R155L probably damaging Het
Ifnlr1 C A 4: 135,705,269 Q339K probably damaging Het
Ifnlr1 A T 4: 135,705,270 Q339L probably damaging Het
Irf4 T A 13: 30,757,758 S365T probably benign Het
Klrb1a T G 6: 128,618,509 D124A probably damaging Het
Macf1 A T 4: 123,476,039 I78N probably damaging Het
Mctp1 G T 13: 76,759,825 probably null Het
Mxra8 A T 4: 155,843,303 probably null Het
Nlrp2 T A 7: 5,324,903 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
P2ry13 T C 3: 59,209,365 T331A probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Pcdhb15 A T 18: 37,474,654 Q313L probably benign Het
Pcdhga11 A G 18: 37,755,992 I18V probably benign Het
Pcdhga11 A G 18: 37,758,089 R717G probably benign Het
Pcif1 C A 2: 164,884,492 probably benign Het
Pkd1l1 T C 11: 8,863,849 T1501A probably benign Het
Plekhg2 C A 7: 28,364,602 R473L probably damaging Het
Plekhn1 T C 4: 156,222,695 Y466C probably damaging Het
Sec22c A G 9: 121,690,302 S83P possibly damaging Het
Sgcz T A 8: 37,526,271 Q224L possibly damaging Het
Slc27a1 C T 8: 71,584,263 P381L probably benign Het
Slc8a1 T A 17: 81,648,002 I536F probably damaging Het
Src T A 2: 157,466,030 probably null Het
Sybu T A 15: 44,787,621 T96S probably damaging Het
Tbc1d22a T C 15: 86,351,728 Y363H probably damaging Het
Tdrd6 T C 17: 43,628,411 E582G possibly damaging Het
Tmem131 C A 1: 36,819,128 V713L probably benign Het
Tnfsf13b T A 8: 10,006,988 L49Q probably damaging Het
Trem2 T A 17: 48,346,633 probably benign Het
Tspyl3 T A 2: 153,224,716 M201L probably benign Het
Ttl A G 2: 129,076,041 D141G probably benign Het
Ube2z A G 11: 96,061,063 V153A possibly damaging Het
Ubr3 A G 2: 70,021,215 Y1842C probably damaging Het
Usp33 T C 3: 152,380,592 V656A probably damaging Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Vmo1 A T 11: 70,514,415 V63D probably damaging Het
Zcwpw1 T A 5: 137,800,007 D155E probably benign Het
Zeb1 T G 18: 5,766,765 S425R possibly damaging Het
Other mutations in Cep95
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cep95 APN 11 106818217 missense probably damaging 0.98
IGL00988:Cep95 APN 11 106806394 missense probably benign 0.00
IGL01306:Cep95 APN 11 106813815 missense probably benign 0.00
IGL01995:Cep95 APN 11 106806371 missense probably damaging 1.00
IGL02541:Cep95 APN 11 106815581 missense probably damaging 0.99
ANU23:Cep95 UTSW 11 106813815 missense probably benign 0.00
R0071:Cep95 UTSW 11 106790728 unclassified probably benign
R0071:Cep95 UTSW 11 106790728 unclassified probably benign
R0255:Cep95 UTSW 11 106811271 missense probably benign 0.10
R0427:Cep95 UTSW 11 106790752 missense probably benign 0.18
R0436:Cep95 UTSW 11 106818685 missense probably null 0.98
R0583:Cep95 UTSW 11 106814623 missense probably benign
R0831:Cep95 UTSW 11 106814704 missense probably benign 0.00
R1459:Cep95 UTSW 11 106817955 missense probably damaging 1.00
R1589:Cep95 UTSW 11 106800104 missense probably benign 0.00
R1627:Cep95 UTSW 11 106809705 missense probably damaging 1.00
R1768:Cep95 UTSW 11 106806351 nonsense probably null
R1914:Cep95 UTSW 11 106814638 missense probably damaging 1.00
R1915:Cep95 UTSW 11 106814638 missense probably damaging 1.00
R1928:Cep95 UTSW 11 106790728 unclassified probably benign
R2495:Cep95 UTSW 11 106809282 missense possibly damaging 0.73
R3157:Cep95 UTSW 11 106809187 splice site probably benign
R3158:Cep95 UTSW 11 106809187 splice site probably benign
R3712:Cep95 UTSW 11 106811286 nonsense probably null
R3881:Cep95 UTSW 11 106806292 missense probably damaging 0.98
R4739:Cep95 UTSW 11 106815734 missense probably benign 0.34
R4908:Cep95 UTSW 11 106811346 missense probably damaging 1.00
R4989:Cep95 UTSW 11 106816654 unclassified probably null
R5925:Cep95 UTSW 11 106812401 missense probably benign 0.00
R6291:Cep95 UTSW 11 106815596 missense probably damaging 1.00
R6540:Cep95 UTSW 11 106801502 missense probably damaging 0.97
R6924:Cep95 UTSW 11 106811197 missense probably damaging 0.99
R6985:Cep95 UTSW 11 106818703 missense probably damaging 0.99
R7156:Cep95 UTSW 11 106809224 missense possibly damaging 0.84
X0028:Cep95 UTSW 11 106812410 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGGCTCAGGTAATAATGGACAG -3'
(R):5'- ACTGGAAGGAAGCCAACTGC -3'

Sequencing Primer
(F):5'- CTCAGGTAATAATGGACAGGACAG -3'
(R):5'- CAACTGCAGCCGAGCTTTGAAG -3'
Posted On2017-02-28