Incidental Mutation 'R5913:Tdrd6'
ID461147
Institutional Source Beutler Lab
Gene Symbol Tdrd6
Ensembl Gene ENSMUSG00000040140
Gene Nametudor domain containing 6
Synonyms
MMRRC Submission 044110-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5913 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location43615335-43630299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43628411 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 582 (E582G)
Ref Sequence ENSEMBL: ENSMUSP00000131277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045717] [ENSMUST00000168073]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045717
AA Change: E582G

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035338
Gene: ENSMUSG00000040140
AA Change: E582G

DomainStartEndE-ValueType
Pfam:TUDOR 14 133 9.9e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2026 2083 9.45e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000168073
AA Change: E582G

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131277
Gene: ENSMUSG00000040140
AA Change: E582G

DomainStartEndE-ValueType
Pfam:TUDOR 12 133 7.2e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2027 2084 9.45e-1 SMART
Meta Mutation Damage Score 0.2892 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tudor domain-containing protein and component of the chromatoid body, a type of ribonucleoprotein granule present in male germ cells. Studies in rodents have demonstrated a role for the encoded protein in spermiogenesis and the nonsense mediated decay (NMD) pathway. This protein is a major autoantigen in human patients with autoimmune polyendocrine syndrome type 1 (APS1). [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit male fertility associated with arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A T 9: 110,889,705 probably null Het
Arhgef19 A T 4: 141,249,298 H457L probably benign Het
Armc3 A G 2: 19,310,047 Y856C possibly damaging Het
Bdp1 A T 13: 100,051,104 V1585D probably benign Het
Bhlhe40 T G 6: 108,665,193 M366R possibly damaging Het
Bora C T 14: 99,068,512 S439L probably benign Het
Cacnb4 G A 2: 52,434,784 probably benign Het
Carm1 T C 9: 21,587,552 S529P probably benign Het
Cd200r1 A G 16: 44,789,671 I84M possibly damaging Het
Cd209a A G 8: 3,748,742 S22P probably benign Het
Celf2 A T 2: 7,081,158 M1K probably null Het
Cep112 A G 11: 108,757,688 T783A probably damaging Het
Cep95 T C 11: 106,818,509 probably benign Het
Clip4 G A 17: 71,824,765 R366K probably benign Het
Csmd2 A G 4: 128,551,988 K3284E probably benign Het
Csn3 T A 5: 87,927,611 L12Q probably damaging Het
Ctdnep1 T C 11: 69,988,865 L39P probably damaging Het
Cxcl17 C T 7: 25,402,246 W55* probably null Het
Cyp2u1 G A 3: 131,303,211 probably benign Het
Dmgdh A T 13: 93,752,323 E823V possibly damaging Het
Dnah2 T C 11: 69,448,430 I3078V probably damaging Het
Dpp10 A C 1: 123,384,289 Y446D probably damaging Het
Eif2s3y T C Y: 1,017,365 V290A probably benign Homo
Fktn G A 4: 53,735,035 W224* probably null Het
Gm37240 T C 3: 84,967,598 probably benign Het
Gm9573 C T 17: 35,623,231 probably benign Het
Gpr3 A G 4: 133,211,178 V61A probably damaging Het
Gulo T C 14: 66,000,021 probably null Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hectd4 T A 5: 121,323,974 I968K possibly damaging Het
Hmox2 G T 16: 4,764,868 R155L probably damaging Het
Ifnlr1 C A 4: 135,705,269 Q339K probably damaging Het
Ifnlr1 A T 4: 135,705,270 Q339L probably damaging Het
Irf4 T A 13: 30,757,758 S365T probably benign Het
Klrb1a T G 6: 128,618,509 D124A probably damaging Het
Macf1 A T 4: 123,476,039 I78N probably damaging Het
Mctp1 G T 13: 76,759,825 probably null Het
Mxra8 A T 4: 155,843,303 probably null Het
Nlrp2 T A 7: 5,324,903 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
P2ry13 T C 3: 59,209,365 T331A probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Pcdhb15 A T 18: 37,474,654 Q313L probably benign Het
Pcdhga11 A G 18: 37,755,992 I18V probably benign Het
Pcdhga11 A G 18: 37,758,089 R717G probably benign Het
Pcif1 C A 2: 164,884,492 probably benign Het
Pkd1l1 T C 11: 8,863,849 T1501A probably benign Het
Plekhg2 C A 7: 28,364,602 R473L probably damaging Het
Plekhn1 T C 4: 156,222,695 Y466C probably damaging Het
Sec22c A G 9: 121,690,302 S83P possibly damaging Het
Sgcz T A 8: 37,526,271 Q224L possibly damaging Het
Slc27a1 C T 8: 71,584,263 P381L probably benign Het
Slc8a1 T A 17: 81,648,002 I536F probably damaging Het
Src T A 2: 157,466,030 probably null Het
Sybu T A 15: 44,787,621 T96S probably damaging Het
Tbc1d22a T C 15: 86,351,728 Y363H probably damaging Het
Tmem131 C A 1: 36,819,128 V713L probably benign Het
Tnfsf13b T A 8: 10,006,988 L49Q probably damaging Het
Trem2 T A 17: 48,346,633 probably benign Het
Tspyl3 T A 2: 153,224,716 M201L probably benign Het
Ttl A G 2: 129,076,041 D141G probably benign Het
Ube2z A G 11: 96,061,063 V153A possibly damaging Het
Ubr3 A G 2: 70,021,215 Y1842C probably damaging Het
Usp33 T C 3: 152,380,592 V656A probably damaging Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Vmo1 A T 11: 70,514,415 V63D probably damaging Het
Zcwpw1 T A 5: 137,800,007 D155E probably benign Het
Zeb1 T G 18: 5,766,765 S425R possibly damaging Het
Other mutations in Tdrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tdrd6 APN 17 43628160 missense probably damaging 0.96
IGL00844:Tdrd6 APN 17 43617196 missense probably benign
IGL00845:Tdrd6 APN 17 43626716 missense probably benign 0.06
IGL01558:Tdrd6 APN 17 43625768 missense probably damaging 1.00
IGL01558:Tdrd6 APN 17 43624766 missense probably benign 0.02
IGL01575:Tdrd6 APN 17 43627980 missense probably benign 0.00
IGL01812:Tdrd6 APN 17 43625174 missense probably benign 0.10
IGL02013:Tdrd6 APN 17 43625946 missense probably benign 0.00
IGL02067:Tdrd6 APN 17 43628209 missense probably damaging 1.00
IGL02112:Tdrd6 APN 17 43629351 missense probably damaging 1.00
IGL02159:Tdrd6 APN 17 43628390 missense probably damaging 1.00
IGL02226:Tdrd6 APN 17 43627202 missense probably damaging 1.00
IGL02416:Tdrd6 APN 17 43624738 missense probably benign 0.39
IGL02577:Tdrd6 APN 17 43626837 missense probably damaging 0.99
IGL02631:Tdrd6 APN 17 43626219 missense probably damaging 1.00
IGL02738:Tdrd6 APN 17 43620446 missense probably benign 0.06
IGL02792:Tdrd6 APN 17 43625027 missense probably benign
IGL02929:Tdrd6 APN 17 43629713 missense possibly damaging 0.61
IGL02934:Tdrd6 APN 17 43627887 missense probably benign 0.42
IGL02954:Tdrd6 APN 17 43627262 missense possibly damaging 0.82
IGL02969:Tdrd6 APN 17 43627549 missense probably damaging 0.98
IGL03006:Tdrd6 APN 17 43625432 missense probably damaging 1.00
IGL03155:Tdrd6 APN 17 43625507 missense probably damaging 1.00
IGL03219:Tdrd6 APN 17 43627964 missense probably benign 0.04
IGL03372:Tdrd6 APN 17 43625568 missense probably damaging 1.00
R0030:Tdrd6 UTSW 17 43626591 missense possibly damaging 0.80
R0057:Tdrd6 UTSW 17 43617161 splice site probably benign
R0090:Tdrd6 UTSW 17 43628241 missense probably benign 0.00
R0270:Tdrd6 UTSW 17 43624308 missense probably benign
R0463:Tdrd6 UTSW 17 43625561 missense probably damaging 1.00
R0594:Tdrd6 UTSW 17 43629383 missense probably damaging 1.00
R0650:Tdrd6 UTSW 17 43628159 missense probably damaging 0.99
R1226:Tdrd6 UTSW 17 43626632 missense possibly damaging 0.63
R1309:Tdrd6 UTSW 17 43626621 missense probably benign
R1483:Tdrd6 UTSW 17 43627607 missense probably benign 0.31
R1561:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1574:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1647:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1648:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1723:Tdrd6 UTSW 17 43628327 missense possibly damaging 0.94
R1786:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R1819:Tdrd6 UTSW 17 43626551 missense probably benign 0.00
R1836:Tdrd6 UTSW 17 43625589 missense probably benign 0.03
R1892:Tdrd6 UTSW 17 43624805 missense probably benign 0.00
R1911:Tdrd6 UTSW 17 43627088 missense probably benign 0.21
R1936:Tdrd6 UTSW 17 43626467 missense probably damaging 0.98
R2005:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2006:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2132:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R2133:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R3010:Tdrd6 UTSW 17 43628042 missense probably benign 0.00
R4225:Tdrd6 UTSW 17 43625973 missense probably damaging 1.00
R4448:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4449:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4531:Tdrd6 UTSW 17 43628754 missense probably damaging 0.98
R4624:Tdrd6 UTSW 17 43625990 missense probably damaging 0.99
R4665:Tdrd6 UTSW 17 43624116 missense probably benign
R4676:Tdrd6 UTSW 17 43627610 missense probably damaging 0.96
R4785:Tdrd6 UTSW 17 43625576 missense probably damaging 1.00
R4912:Tdrd6 UTSW 17 43624327 missense probably benign 0.34
R5134:Tdrd6 UTSW 17 43626210 missense probably damaging 1.00
R5145:Tdrd6 UTSW 17 43626075 missense probably damaging 0.96
R5623:Tdrd6 UTSW 17 43629333 missense probably damaging 1.00
R5712:Tdrd6 UTSW 17 43626408 missense probably damaging 1.00
R5897:Tdrd6 UTSW 17 43624877 missense probably damaging 0.98
R6142:Tdrd6 UTSW 17 43629482 missense probably benign 0.01
R6181:Tdrd6 UTSW 17 43628897 missense probably damaging 1.00
R6195:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6233:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6289:Tdrd6 UTSW 17 43624520 missense probably benign 0.01
R6315:Tdrd6 UTSW 17 43626338 missense probably benign 0.02
R6578:Tdrd6 UTSW 17 43628961 missense possibly damaging 0.65
R6645:Tdrd6 UTSW 17 43624532 missense probably benign 0.10
R6822:Tdrd6 UTSW 17 43627215 missense probably damaging 1.00
R7000:Tdrd6 UTSW 17 43627708 missense probably benign 0.28
R7075:Tdrd6 UTSW 17 43625174 missense probably benign 0.10
R7107:Tdrd6 UTSW 17 43624204 missense probably benign 0.00
R7381:Tdrd6 UTSW 17 43626093 missense probably benign 0.00
R7458:Tdrd6 UTSW 17 43625046 missense probably benign 0.02
R7461:Tdrd6 UTSW 17 43627926 missense probably benign 0.00
R7505:Tdrd6 UTSW 17 43627679 missense not run
R7583:Tdrd6 UTSW 17 43624238 missense probably benign 0.29
R7613:Tdrd6 UTSW 17 43627926 missense probably benign 0.00
R7723:Tdrd6 UTSW 17 43625960 missense probably benign 0.09
R7759:Tdrd6 UTSW 17 43624839 missense probably benign 0.00
R8002:Tdrd6 UTSW 17 43629819
X0065:Tdrd6 UTSW 17 43625153 missense possibly damaging 0.80
X0065:Tdrd6 UTSW 17 43625993 missense probably damaging 0.99
Z1088:Tdrd6 UTSW 17 43626518 missense probably benign 0.23
Z1177:Tdrd6 UTSW 17 43627187
Predicted Primers PCR Primer
(F):5'- CTGCTTATCAAGAACATGGACCAC -3'
(R):5'- CTGGATTCGCCTTAGAAAGCAC -3'

Sequencing Primer
(F):5'- GGACCACCAATTCTTTGTGGAGTAC -3'
(R):5'- CTGACGAAGAGAATGTGCAGTTTC -3'
Posted On2017-02-28