Incidental Mutation 'R5913:Clip4'
ID461149
Institutional Source Beutler Lab
Gene Symbol Clip4
Ensembl Gene ENSMUSG00000024059
Gene NameCAP-GLY domain containing linker protein family, member 4
Synonyms1700024K14Rik, Rsnl2, 1700074B05Rik, 4833417L20Rik, 5830409B12Rik
MMRRC Submission 044110-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R5913 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location71768473-71864273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71824765 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 366 (R366K)
Ref Sequence ENSEMBL: ENSMUSP00000154969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024854] [ENSMUST00000229304] [ENSMUST00000229874] [ENSMUST00000229952] [ENSMUST00000230305] [ENSMUST00000230333] [ENSMUST00000230747] [ENSMUST00000230749] [ENSMUST00000231105]
Predicted Effect probably benign
Transcript: ENSMUST00000024854
AA Change: R366K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024854
Gene: ENSMUSG00000024059
AA Change: R366K

DomainStartEndE-ValueType
ANK 106 144 4.58e2 SMART
ANK 149 180 3.26e0 SMART
ANK 186 215 3.26e0 SMART
CAP_GLY 285 350 6.63e-34 SMART
low complexity region 358 371 N/A INTRINSIC
low complexity region 389 403 N/A INTRINSIC
low complexity region 423 432 N/A INTRINSIC
low complexity region 440 461 N/A INTRINSIC
low complexity region 469 478 N/A INTRINSIC
CAP_GLY 486 551 5.52e-31 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
CAP_GLY 624 690 5.65e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229014
Predicted Effect probably benign
Transcript: ENSMUST00000229304
AA Change: R366K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000229874
AA Change: R366K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000229952
Predicted Effect unknown
Transcript: ENSMUST00000230160
AA Change: R58K
Predicted Effect probably benign
Transcript: ENSMUST00000230305
AA Change: R366K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230333
AA Change: R366K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230747
AA Change: R366K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000230749
AA Change: R366K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230845
Predicted Effect probably benign
Transcript: ENSMUST00000231105
Predicted Effect probably benign
Transcript: ENSMUST00000231131
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.3%
Validation Efficiency 97% (75/77)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Als2cl A T 9: 110,889,705 probably null Het
Arhgef19 A T 4: 141,249,298 H457L probably benign Het
Armc3 A G 2: 19,310,047 Y856C possibly damaging Het
Bdp1 A T 13: 100,051,104 V1585D probably benign Het
Bhlhe40 T G 6: 108,665,193 M366R possibly damaging Het
Bora C T 14: 99,068,512 S439L probably benign Het
Cacnb4 G A 2: 52,434,784 probably benign Het
Carm1 T C 9: 21,587,552 S529P probably benign Het
Cd200r1 A G 16: 44,789,671 I84M possibly damaging Het
Cd209a A G 8: 3,748,742 S22P probably benign Het
Celf2 A T 2: 7,081,158 M1K probably null Het
Cep112 A G 11: 108,757,688 T783A probably damaging Het
Cep95 T C 11: 106,818,509 probably benign Het
Csmd2 A G 4: 128,551,988 K3284E probably benign Het
Csn3 T A 5: 87,927,611 L12Q probably damaging Het
Ctdnep1 T C 11: 69,988,865 L39P probably damaging Het
Cxcl17 C T 7: 25,402,246 W55* probably null Het
Cyp2u1 G A 3: 131,303,211 probably benign Het
Dmgdh A T 13: 93,752,323 E823V possibly damaging Het
Dnah2 T C 11: 69,448,430 I3078V probably damaging Het
Dpp10 A C 1: 123,384,289 Y446D probably damaging Het
Eif2s3y T C Y: 1,017,365 V290A probably benign Homo
Fktn G A 4: 53,735,035 W224* probably null Het
Gm37240 T C 3: 84,967,598 probably benign Het
Gm9573 C T 17: 35,623,231 probably benign Het
Gpr3 A G 4: 133,211,178 V61A probably damaging Het
Gulo T C 14: 66,000,021 probably null Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hectd4 T A 5: 121,323,974 I968K possibly damaging Het
Hmox2 G T 16: 4,764,868 R155L probably damaging Het
Ifnlr1 C A 4: 135,705,269 Q339K probably damaging Het
Ifnlr1 A T 4: 135,705,270 Q339L probably damaging Het
Irf4 T A 13: 30,757,758 S365T probably benign Het
Klrb1a T G 6: 128,618,509 D124A probably damaging Het
Macf1 A T 4: 123,476,039 I78N probably damaging Het
Mctp1 G T 13: 76,759,825 probably null Het
Mxra8 A T 4: 155,843,303 probably null Het
Nlrp2 T A 7: 5,324,903 probably null Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
P2ry13 T C 3: 59,209,365 T331A probably benign Het
Padi2 G A 4: 140,917,641 R62H probably benign Het
Pcdhb15 A T 18: 37,474,654 Q313L probably benign Het
Pcdhga11 A G 18: 37,755,992 I18V probably benign Het
Pcdhga11 A G 18: 37,758,089 R717G probably benign Het
Pcif1 C A 2: 164,884,492 probably benign Het
Pkd1l1 T C 11: 8,863,849 T1501A probably benign Het
Plekhg2 C A 7: 28,364,602 R473L probably damaging Het
Plekhn1 T C 4: 156,222,695 Y466C probably damaging Het
Sec22c A G 9: 121,690,302 S83P possibly damaging Het
Sgcz T A 8: 37,526,271 Q224L possibly damaging Het
Slc27a1 C T 8: 71,584,263 P381L probably benign Het
Slc8a1 T A 17: 81,648,002 I536F probably damaging Het
Src T A 2: 157,466,030 probably null Het
Sybu T A 15: 44,787,621 T96S probably damaging Het
Tbc1d22a T C 15: 86,351,728 Y363H probably damaging Het
Tdrd6 T C 17: 43,628,411 E582G possibly damaging Het
Tmem131 C A 1: 36,819,128 V713L probably benign Het
Tnfsf13b T A 8: 10,006,988 L49Q probably damaging Het
Trem2 T A 17: 48,346,633 probably benign Het
Tspyl3 T A 2: 153,224,716 M201L probably benign Het
Ttl A G 2: 129,076,041 D141G probably benign Het
Ube2z A G 11: 96,061,063 V153A possibly damaging Het
Ubr3 A G 2: 70,021,215 Y1842C probably damaging Het
Usp33 T C 3: 152,380,592 V656A probably damaging Het
Vmn2r74 G A 7: 85,951,890 R847C probably damaging Het
Vmo1 A T 11: 70,514,415 V63D probably damaging Het
Zcwpw1 T A 5: 137,800,007 D155E probably benign Het
Zeb1 T G 18: 5,766,765 S425R possibly damaging Het
Other mutations in Clip4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Clip4 APN 17 71849942 missense probably damaging 1.00
IGL01011:Clip4 APN 17 71849939 missense probably benign 0.02
IGL01086:Clip4 APN 17 71824794 missense probably benign 0.00
IGL01712:Clip4 APN 17 71799041 missense probably damaging 1.00
IGL01833:Clip4 APN 17 71827790 unclassified probably benign
IGL02150:Clip4 APN 17 71799076 missense probably damaging 1.00
IGL02378:Clip4 APN 17 71837726 missense possibly damaging 0.94
IGL02597:Clip4 APN 17 71849970 splice site probably benign
IGL02676:Clip4 APN 17 71828621 missense probably damaging 1.00
PIT4243001:Clip4 UTSW 17 71806728 missense probably damaging 0.98
R0525:Clip4 UTSW 17 71799098 critical splice donor site probably null
R0737:Clip4 UTSW 17 71837699 nonsense probably null
R1791:Clip4 UTSW 17 71801942 splice site probably benign
R1908:Clip4 UTSW 17 71837749 missense probably damaging 1.00
R2290:Clip4 UTSW 17 71810953 missense possibly damaging 0.96
R3701:Clip4 UTSW 17 71799008 missense probably damaging 0.96
R4001:Clip4 UTSW 17 71799076 missense probably damaging 1.00
R4013:Clip4 UTSW 17 71856546 nonsense probably null
R4589:Clip4 UTSW 17 71810867 nonsense probably null
R4837:Clip4 UTSW 17 71834222 missense probably damaging 1.00
R5174:Clip4 UTSW 17 71810962 missense probably damaging 1.00
R5239:Clip4 UTSW 17 71799077 missense probably damaging 1.00
R5298:Clip4 UTSW 17 71834225 missense probably damaging 1.00
R5535:Clip4 UTSW 17 71831262 missense probably benign
R5667:Clip4 UTSW 17 71789883 start codon destroyed probably damaging 1.00
R5671:Clip4 UTSW 17 71789883 start codon destroyed probably damaging 1.00
R5730:Clip4 UTSW 17 71810959 missense probably damaging 1.00
R5768:Clip4 UTSW 17 71806499 splice site probably null
R5974:Clip4 UTSW 17 71831247 missense probably damaging 1.00
R5996:Clip4 UTSW 17 71856310 missense probably damaging 0.99
R6176:Clip4 UTSW 17 71806633 nonsense probably null
R6371:Clip4 UTSW 17 71856464 missense probably damaging 1.00
R6386:Clip4 UTSW 17 71834194 nonsense probably null
R7296:Clip4 UTSW 17 71790001 missense probably damaging 0.99
R7548:Clip4 UTSW 17 71789968 missense probably benign
R7616:Clip4 UTSW 17 71834273 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAGATGCATGGTGGGTACG -3'
(R):5'- GTCATATTCATAACTGAGGCCCAAG -3'

Sequencing Primer
(F):5'- TACGGACAGAGGTAGCCTG -3'
(R):5'- CACCAAGGCCTTGCTTTTGTGAG -3'
Posted On2017-02-28