Incidental Mutation 'R5914:Ino80'
ID461171
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene NameINO80 complex subunit
SynonymsINO80, 2310079N15Rik, 4632409L19Rik, Inoc1
MMRRC Submission 044111-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R5914 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119373042-119477687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119458216 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 3 (S3L)
Ref Sequence ENSEMBL: ENSMUSP00000051845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]
Predicted Effect probably damaging
Transcript: ENSMUST00000049920
AA Change: S3L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: S3L

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110808
AA Change: S3L

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154
AA Change: S3L

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 272 412 8.8e-55 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
PDB:3MWY|W 1098 1136 6e-7 PDB
Meta Mutation Damage Score 0.1321 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,538,370 R286H possibly damaging Het
Ank3 A T 10: 69,992,944 probably benign Het
Arhgap24 G A 5: 102,552,159 probably null Het
Arhgef2 T C 3: 88,635,869 Y396H probably benign Het
Asap3 G T 4: 136,241,409 G722C probably benign Het
Birc3 A C 9: 7,857,342 *377E probably null Het
Cdc123 G T 2: 5,798,363 Q282K possibly damaging Het
Cdkl4 C T 17: 80,547,691 probably null Het
Cep97 T C 16: 55,905,457 N689S probably benign Het
Cfap97 T G 8: 46,181,858 S407A probably damaging Het
Cfh A T 1: 140,136,229 N436K probably benign Het
Chpf2 A T 5: 24,592,423 probably benign Het
Cnnm2 A G 19: 46,763,177 T469A probably benign Het
Col6a3 T A 1: 90,776,200 I2275F unknown Het
Ctdspl2 A T 2: 121,978,933 N122Y probably damaging Het
Dcaf6 A T 1: 165,351,155 C602S probably benign Het
Dda1 T A 8: 71,474,650 probably benign Het
Dixdc1 T C 9: 50,698,588 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Emilin3 T A 2: 160,909,070 N253I probably damaging Het
Epg5 T A 18: 77,959,632 probably null Het
Fam204a A T 19: 60,221,093 Y68* probably null Het
Fbln5 T G 12: 101,760,743 D329A possibly damaging Het
Fkbp15 T A 4: 62,327,810 probably null Het
Fnbp4 C G 2: 90,774,793 probably benign Het
Foxn2 C A 17: 88,462,710 probably null Het
Frem1 T C 4: 83,001,775 D448G probably damaging Het
Fzd9 T C 5: 135,249,345 Y562C probably benign Het
Gcn1l1 A G 5: 115,610,135 silent Het
Gm6003 A G 7: 33,165,266 noncoding transcript Het
Gnl3 C A 14: 31,016,896 E65D possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk2 C T 6: 82,736,634 R461K probably benign Het
Ice1 A G 13: 70,606,377 F530S possibly damaging Het
Ing3 T A 6: 21,968,905 S129T probably benign Het
Ints2 T A 11: 86,222,174 Q839H probably benign Het
Kcnrg T C 14: 61,611,831 M247T probably benign Het
Kpna6 T C 4: 129,672,692 probably benign Het
Krtap28-13 T A 1: 83,061,323 probably benign Het
Lgr4 T A 2: 109,918,272 V51E possibly damaging Het
Map3k5 A C 10: 20,104,255 E836D probably benign Het
Mapk11 T C 15: 89,145,835 I193V probably benign Het
March10 A T 11: 105,385,482 V660E probably damaging Het
Matn4 T C 2: 164,393,224 E435G probably damaging Het
Mre11a G T 9: 14,811,936 R402M probably damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Ndufv3 C T 17: 31,531,232 R99* probably null Het
Nkx6-1 C T 5: 101,663,981 S85N unknown Het
Nop2 A T 6: 125,134,728 E141D probably benign Het
Olfr1469 A G 19: 13,410,962 H131R probably benign Het
Olfr906 G C 9: 38,488,361 E111Q probably damaging Het
Paox T C 7: 140,129,188 S205P probably damaging Het
Pcdh15 T C 10: 74,630,936 V995A probably benign Het
Pdcd1 T A 1: 94,040,825 K161N probably benign Het
Pfkfb2 C A 1: 130,700,095 V372L probably damaging Het
Phldb1 G A 9: 44,711,651 T19I probably damaging Het
Pik3c2g G T 6: 139,622,479 V198L probably benign Het
Pnpla8 T A 12: 44,295,970 L41* probably null Het
Postn C T 3: 54,373,800 Q449* probably null Het
Ppp1r3a C T 6: 14,718,989 S642N probably benign Het
Ptpn23 G A 9: 110,385,443 probably benign Het
Ptprj T C 2: 90,453,340 N923S possibly damaging Het
Rai1 T C 11: 60,187,804 V898A probably benign Het
Rasgef1a A T 6: 118,080,554 Y72F possibly damaging Het
Serpinb7 T C 1: 107,451,850 V329A probably damaging Het
Slc24a4 T A 12: 102,234,790 I311N probably damaging Het
Slc45a1 C A 4: 150,629,540 L749F possibly damaging Het
Spon1 G A 7: 114,030,821 D428N probably damaging Het
Tcf7l2 G A 19: 55,898,560 E2K probably benign Het
Thoc5 A G 11: 4,920,416 M472V possibly damaging Het
Tm6sf2 T C 8: 70,075,563 Y121H probably damaging Het
Tmc4 T A 7: 3,672,009 D221V probably benign Het
Trim30b A T 7: 104,357,365 S95T probably damaging Het
Trip12 T C 1: 84,763,458 E571G probably damaging Het
Ttn T C 2: 76,951,312 probably null Het
Ubp1 A T 9: 113,956,739 R161W probably benign Het
Usp21 G A 1: 171,282,171 probably benign Het
Vmn1r61 T A 7: 5,610,530 R262W probably damaging Het
Vmn2r67 A T 7: 85,151,836 D297E probably damaging Het
Vwa5a T C 9: 38,741,742 L784S probably benign Het
Vwc2 G A 11: 11,154,244 V259M probably damaging Het
Zeb2 T C 2: 44,997,052 I596M probably benign Het
Zgrf1 T A 3: 127,561,023 L97H probably damaging Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
PIT4677001:Ino80 UTSW 2 119377545 missense probably benign
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0114:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0189:Ino80 UTSW 2 119379679 missense probably benign 0.36
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0365:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1506:Ino80 UTSW 2 119425265 nonsense probably null
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1773:Ino80 UTSW 2 119418409 missense probably benign 0.18
R1795:Ino80 UTSW 2 119406859 missense probably damaging 1.00
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R4919:Ino80 UTSW 2 119442592 missense probably damaging 1.00
R5113:Ino80 UTSW 2 119431945 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5531:Ino80 UTSW 2 119445575 missense probably benign
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
R7052:Ino80 UTSW 2 119426587 critical splice donor site probably null
R7100:Ino80 UTSW 2 119374513 missense possibly damaging 0.47
R7163:Ino80 UTSW 2 119392875 missense probably damaging 1.00
R7187:Ino80 UTSW 2 119426591 missense probably benign 0.00
R7202:Ino80 UTSW 2 119374437 missense probably benign 0.00
R7218:Ino80 UTSW 2 119458127 missense probably benign
R7389:Ino80 UTSW 2 119442529 missense probably benign 0.00
R7419:Ino80 UTSW 2 119380014 missense probably benign 0.00
R7437:Ino80 UTSW 2 119442586 missense possibly damaging 0.86
R7702:Ino80 UTSW 2 119442573 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGAGTGAGTTCCAGGACAGCC -3'
(R):5'- GAGGCAGTGTCTAATGAACTTTC -3'

Sequencing Primer
(F):5'- TTCCAGGACAGCCAGGGATAC -3'
(R):5'- GCAGTGTCTAATGAACTTTCTGTAG -3'
Posted On2017-02-28