Incidental Mutation 'R5914:Arhgef2'
ID461176
Institutional Source Beutler Lab
Gene Symbol Arhgef2
Ensembl Gene ENSMUSG00000028059
Gene Namerho/rac guanine nucleotide exchange factor (GEF) 2
SynonymsP40, Lfc, Lbcl1, GEFH1, LFP40, GEF-H1
MMRRC Submission 044111-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #R5914 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location88605966-88648052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88635869 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 396 (Y396H)
Ref Sequence ENSEMBL: ENSMUSP00000134840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029694] [ENSMUST00000107510] [ENSMUST00000170653] [ENSMUST00000175745] [ENSMUST00000175779] [ENSMUST00000175903] [ENSMUST00000175911] [ENSMUST00000176243] [ENSMUST00000176307] [ENSMUST00000176316] [ENSMUST00000176500] [ENSMUST00000176539] [ENSMUST00000176804] [ENSMUST00000176879] [ENSMUST00000177023] [ENSMUST00000177303] [ENSMUST00000177498]
Predicted Effect probably benign
Transcript: ENSMUST00000029694
AA Change: Y413H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029694
Gene: ENSMUSG00000028059
AA Change: Y413H

DomainStartEndE-ValueType
C1 40 86 4.22e-9 SMART
low complexity region 90 95 N/A INTRINSIC
low complexity region 133 146 N/A INTRINSIC
RhoGEF 240 432 1.86e-58 SMART
PH 474 574 9.56e-11 SMART
coiled coil region 588 619 N/A INTRINSIC
low complexity region 812 827 N/A INTRINSIC
coiled coil region 829 866 N/A INTRINSIC
low complexity region 872 888 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107510
AA Change: Y386H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103134
Gene: ENSMUSG00000028059
AA Change: Y386H

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 106 119 N/A INTRINSIC
RhoGEF 213 405 1.86e-58 SMART
PH 447 547 9.56e-11 SMART
coiled coil region 561 592 N/A INTRINSIC
low complexity region 785 800 N/A INTRINSIC
coiled coil region 802 839 N/A INTRINSIC
low complexity region 845 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170653
AA Change: Y384H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127843
Gene: ENSMUSG00000028059
AA Change: Y384H

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
RhoGEF 211 403 1.86e-58 SMART
PH 445 545 9.56e-11 SMART
coiled coil region 559 590 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
coiled coil region 800 837 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175745
SMART Domains Protein: ENSMUSP00000135044
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175779
AA Change: Y398H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135177
Gene: ENSMUSG00000028059
AA Change: Y398H

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 225 417 1.86e-58 SMART
PH 459 559 9.56e-11 SMART
coiled coil region 573 604 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
coiled coil region 814 851 N/A INTRINSIC
low complexity region 857 873 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175903
AA Change: Y396H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135168
Gene: ENSMUSG00000028059
AA Change: Y396H

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 223 415 1.86e-58 SMART
PH 457 557 9.56e-11 SMART
coiled coil region 571 602 N/A INTRINSIC
low complexity region 795 810 N/A INTRINSIC
coiled coil region 812 849 N/A INTRINSIC
low complexity region 855 871 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175911
AA Change: Y405H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135428
Gene: ENSMUSG00000028059
AA Change: Y405H

DomainStartEndE-ValueType
C1 32 78 4.22e-9 SMART
low complexity region 82 87 N/A INTRINSIC
low complexity region 125 138 N/A INTRINSIC
RhoGEF 232 424 1.86e-58 SMART
PH 466 566 9.56e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176123
Predicted Effect probably benign
Transcript: ENSMUST00000176243
SMART Domains Protein: ENSMUSP00000135771
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
Blast:RhoGEF 170 203 1e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176301
Predicted Effect probably benign
Transcript: ENSMUST00000176307
SMART Domains Protein: ENSMUSP00000134843
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176316
SMART Domains Protein: ENSMUSP00000135808
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 32 78 4.22e-9 SMART
low complexity region 82 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176401
Predicted Effect probably benign
Transcript: ENSMUST00000176500
AA Change: Y398H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134834
Gene: ENSMUSG00000028059
AA Change: Y398H

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
RhoGEF 225 417 1.86e-58 SMART
PH 459 559 9.56e-11 SMART
coiled coil region 573 604 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
coiled coil region 814 851 N/A INTRINSIC
low complexity region 857 873 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176528
Predicted Effect probably benign
Transcript: ENSMUST00000176539
SMART Domains Protein: ENSMUSP00000135612
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
Blast:RhoGEF 184 253 2e-28 BLAST
PDB:4D0N|B 196 255 1e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176804
AA Change: Y411H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135397
Gene: ENSMUSG00000028059
AA Change: Y411H

DomainStartEndE-ValueType
C1 40 86 4.22e-9 SMART
low complexity region 90 95 N/A INTRINSIC
low complexity region 133 146 N/A INTRINSIC
RhoGEF 238 430 1.86e-58 SMART
PH 472 572 9.56e-11 SMART
coiled coil region 586 617 N/A INTRINSIC
low complexity region 810 825 N/A INTRINSIC
coiled coil region 827 864 N/A INTRINSIC
low complexity region 870 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176879
SMART Domains Protein: ENSMUSP00000134766
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 32 78 4.22e-9 SMART
low complexity region 82 87 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177023
SMART Domains Protein: ENSMUSP00000134859
Gene: ENSMUSG00000028059

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
Blast:RhoGEF 182 208 5e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177120
Predicted Effect probably benign
Transcript: ENSMUST00000177303
AA Change: Y384H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135131
Gene: ENSMUSG00000028059
AA Change: Y384H

DomainStartEndE-ValueType
C1 13 59 4.22e-9 SMART
low complexity region 63 68 N/A INTRINSIC
low complexity region 106 119 N/A INTRINSIC
RhoGEF 211 403 1.86e-58 SMART
PH 445 545 9.56e-11 SMART
coiled coil region 559 590 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
coiled coil region 800 837 N/A INTRINSIC
low complexity region 843 859 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177418
Predicted Effect probably benign
Transcript: ENSMUST00000177498
AA Change: Y396H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134840
Gene: ENSMUSG00000028059
AA Change: Y396H

DomainStartEndE-ValueType
C1 25 71 4.22e-9 SMART
low complexity region 75 80 N/A INTRINSIC
low complexity region 116 129 N/A INTRINSIC
RhoGEF 223 415 1.86e-58 SMART
PH 457 557 9.56e-11 SMART
coiled coil region 571 602 N/A INTRINSIC
low complexity region 795 810 N/A INTRINSIC
coiled coil region 812 849 N/A INTRINSIC
low complexity region 855 871 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate rho-dependent signals. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired response to viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,538,370 R286H possibly damaging Het
Ank3 A T 10: 69,992,944 probably benign Het
Arhgap24 G A 5: 102,552,159 probably null Het
Asap3 G T 4: 136,241,409 G722C probably benign Het
Birc3 A C 9: 7,857,342 *377E probably null Het
Cdc123 G T 2: 5,798,363 Q282K possibly damaging Het
Cdkl4 C T 17: 80,547,691 probably null Het
Cep97 T C 16: 55,905,457 N689S probably benign Het
Cfap97 T G 8: 46,181,858 S407A probably damaging Het
Cfh A T 1: 140,136,229 N436K probably benign Het
Chpf2 A T 5: 24,592,423 probably benign Het
Cnnm2 A G 19: 46,763,177 T469A probably benign Het
Col6a3 T A 1: 90,776,200 I2275F unknown Het
Ctdspl2 A T 2: 121,978,933 N122Y probably damaging Het
Dcaf6 A T 1: 165,351,155 C602S probably benign Het
Dda1 T A 8: 71,474,650 probably benign Het
Dixdc1 T C 9: 50,698,588 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Emilin3 T A 2: 160,909,070 N253I probably damaging Het
Epg5 T A 18: 77,959,632 probably null Het
Fam204a A T 19: 60,221,093 Y68* probably null Het
Fbln5 T G 12: 101,760,743 D329A possibly damaging Het
Fkbp15 T A 4: 62,327,810 probably null Het
Fnbp4 C G 2: 90,774,793 probably benign Het
Foxn2 C A 17: 88,462,710 probably null Het
Frem1 T C 4: 83,001,775 D448G probably damaging Het
Fzd9 T C 5: 135,249,345 Y562C probably benign Het
Gcn1l1 A G 5: 115,610,135 silent Het
Gm6003 A G 7: 33,165,266 noncoding transcript Het
Gnl3 C A 14: 31,016,896 E65D possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk2 C T 6: 82,736,634 R461K probably benign Het
Ice1 A G 13: 70,606,377 F530S possibly damaging Het
Ing3 T A 6: 21,968,905 S129T probably benign Het
Ino80 G A 2: 119,458,216 S3L probably damaging Het
Ints2 T A 11: 86,222,174 Q839H probably benign Het
Kcnrg T C 14: 61,611,831 M247T probably benign Het
Kpna6 T C 4: 129,672,692 probably benign Het
Krtap28-13 T A 1: 83,061,323 probably benign Het
Lgr4 T A 2: 109,918,272 V51E possibly damaging Het
Map3k5 A C 10: 20,104,255 E836D probably benign Het
Mapk11 T C 15: 89,145,835 I193V probably benign Het
March10 A T 11: 105,385,482 V660E probably damaging Het
Matn4 T C 2: 164,393,224 E435G probably damaging Het
Mre11a G T 9: 14,811,936 R402M probably damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Ndufv3 C T 17: 31,531,232 R99* probably null Het
Nkx6-1 C T 5: 101,663,981 S85N unknown Het
Nop2 A T 6: 125,134,728 E141D probably benign Het
Olfr1469 A G 19: 13,410,962 H131R probably benign Het
Olfr906 G C 9: 38,488,361 E111Q probably damaging Het
Paox T C 7: 140,129,188 S205P probably damaging Het
Pcdh15 T C 10: 74,630,936 V995A probably benign Het
Pdcd1 T A 1: 94,040,825 K161N probably benign Het
Pfkfb2 C A 1: 130,700,095 V372L probably damaging Het
Phldb1 G A 9: 44,711,651 T19I probably damaging Het
Pik3c2g G T 6: 139,622,479 V198L probably benign Het
Pnpla8 T A 12: 44,295,970 L41* probably null Het
Postn C T 3: 54,373,800 Q449* probably null Het
Ppp1r3a C T 6: 14,718,989 S642N probably benign Het
Ptpn23 G A 9: 110,385,443 probably benign Het
Ptprj T C 2: 90,453,340 N923S possibly damaging Het
Rai1 T C 11: 60,187,804 V898A probably benign Het
Rasgef1a A T 6: 118,080,554 Y72F possibly damaging Het
Serpinb7 T C 1: 107,451,850 V329A probably damaging Het
Slc24a4 T A 12: 102,234,790 I311N probably damaging Het
Slc45a1 C A 4: 150,629,540 L749F possibly damaging Het
Spon1 G A 7: 114,030,821 D428N probably damaging Het
Tcf7l2 G A 19: 55,898,560 E2K probably benign Het
Thoc5 A G 11: 4,920,416 M472V possibly damaging Het
Tm6sf2 T C 8: 70,075,563 Y121H probably damaging Het
Tmc4 T A 7: 3,672,009 D221V probably benign Het
Trim30b A T 7: 104,357,365 S95T probably damaging Het
Trip12 T C 1: 84,763,458 E571G probably damaging Het
Ttn T C 2: 76,951,312 probably null Het
Ubp1 A T 9: 113,956,739 R161W probably benign Het
Usp21 G A 1: 171,282,171 probably benign Het
Vmn1r61 T A 7: 5,610,530 R262W probably damaging Het
Vmn2r67 A T 7: 85,151,836 D297E probably damaging Het
Vwa5a T C 9: 38,741,742 L784S probably benign Het
Vwc2 G A 11: 11,154,244 V259M probably damaging Het
Zeb2 T C 2: 44,997,052 I596M probably benign Het
Zgrf1 T A 3: 127,561,023 L97H probably damaging Het
Other mutations in Arhgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01913:Arhgef2 APN 3 88631919 missense probably damaging 1.00
IGL02165:Arhgef2 APN 3 88646220 missense probably damaging 1.00
R0090:Arhgef2 UTSW 3 88639348 missense probably damaging 1.00
R0330:Arhgef2 UTSW 3 88642501 missense probably damaging 1.00
R0414:Arhgef2 UTSW 3 88632268 splice site probably benign
R0631:Arhgef2 UTSW 3 88634436 missense probably damaging 0.99
R1635:Arhgef2 UTSW 3 88639321 critical splice acceptor site probably null
R1688:Arhgef2 UTSW 3 88640300 missense probably benign 0.32
R1751:Arhgef2 UTSW 3 88643953 missense probably damaging 1.00
R1767:Arhgef2 UTSW 3 88643953 missense probably damaging 1.00
R1836:Arhgef2 UTSW 3 88639459 missense probably damaging 1.00
R1853:Arhgef2 UTSW 3 88632915 missense possibly damaging 0.48
R1934:Arhgef2 UTSW 3 88629791 missense probably damaging 0.96
R2155:Arhgef2 UTSW 3 88636044 missense probably damaging 1.00
R2206:Arhgef2 UTSW 3 88629914 missense probably damaging 1.00
R2360:Arhgef2 UTSW 3 88634416 missense probably damaging 1.00
R3916:Arhgef2 UTSW 3 88633033 missense probably damaging 1.00
R4090:Arhgef2 UTSW 3 88643878 missense probably benign 0.01
R4732:Arhgef2 UTSW 3 88631940 nonsense probably null
R4733:Arhgef2 UTSW 3 88631940 nonsense probably null
R4837:Arhgef2 UTSW 3 88632943 missense probably damaging 1.00
R4952:Arhgef2 UTSW 3 88642462 missense probably damaging 1.00
R5152:Arhgef2 UTSW 3 88629568 splice site probably null
R5194:Arhgef2 UTSW 3 88635649 missense probably damaging 1.00
R5250:Arhgef2 UTSW 3 88633648 critical splice donor site probably null
R5334:Arhgef2 UTSW 3 88646329 missense probably damaging 0.96
R5514:Arhgef2 UTSW 3 88642997 missense probably benign 0.01
R5560:Arhgef2 UTSW 3 88634437 missense probably damaging 0.97
R5595:Arhgef2 UTSW 3 88642976 missense probably benign 0.00
R5879:Arhgef2 UTSW 3 88643617 splice site probably null
R5910:Arhgef2 UTSW 3 88635020 missense probably damaging 1.00
R5918:Arhgef2 UTSW 3 88636080 missense probably damaging 1.00
R6181:Arhgef2 UTSW 3 88635620 missense probably damaging 1.00
R6489:Arhgef2 UTSW 3 88643014 missense probably damaging 1.00
R7167:Arhgef2 UTSW 3 88643872 missense possibly damaging 0.56
R7289:Arhgef2 UTSW 3 88635885 missense probably benign
R7318:Arhgef2 UTSW 3 88632303 missense probably damaging 0.98
R7353:Arhgef2 UTSW 3 88635686 missense possibly damaging 0.94
R7402:Arhgef2 UTSW 3 88633566 missense probably damaging 1.00
R7441:Arhgef2 UTSW 3 88643955 missense probably damaging 0.96
V1662:Arhgef2 UTSW 3 88633329 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTCTCCTGGTGACTCAG -3'
(R):5'- TCCGTAAAAGTTCATCTCGGCC -3'

Sequencing Primer
(F):5'- TGTGCTCATCAACAGAATCCTG -3'
(R):5'- CGGTTGTAAATCTCCTGC -3'
Posted On2017-02-28