Incidental Mutation 'R5914:Frem1'
ID461179
Institutional Source Beutler Lab
Gene Symbol Frem1
Ensembl Gene ENSMUSG00000059049
Gene NameFras1 related extracellular matrix protein 1
Synonymseyes2, heb, eye, crf11, QBRICK
MMRRC Submission 044111-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.778) question?
Stock #R5914 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location82897920-83052339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83001775 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 448 (D448G)
Ref Sequence ENSEMBL: ENSMUSP00000125809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]
Predicted Effect probably damaging
Transcript: ENSMUST00000071708
AA Change: D447G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: D447G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 364 508 1.7e-37 PFAM
Pfam:Cadherin_3 509 623 3.7e-18 PFAM
Pfam:Cadherin_3 592 709 8.4e-16 PFAM
Pfam:Cadherin_3 746 894 4.8e-26 PFAM
Pfam:Cadherin_3 863 1009 2.8e-30 PFAM
Pfam:Cadherin_3 1024 1115 6.4e-13 PFAM
Pfam:Cadherin_3 1119 1252 1.4e-17 PFAM
Pfam:Cadherin_3 1243 1393 8.2e-35 PFAM
Pfam:Cadherin_3 1378 1506 2e-22 PFAM
Pfam:Cadherin_3 1506 1616 1e-29 PFAM
Pfam:Cadherin_3 1617 1744 1.5e-14 PFAM
Pfam:Calx-beta 1749 1848 2.6e-10 PFAM
low complexity region 1894 1910 N/A INTRINSIC
CLECT 2065 2188 2.25e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107230
AA Change: D447G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: D447G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 296 967 9.01e-39 PROSPERO
internal_repeat_1 1026 1705 9.01e-39 PROSPERO
Pfam:Calx-beta 1730 1829 6.7e-10 PFAM
low complexity region 1875 1891 N/A INTRINSIC
CLECT 2046 2169 2.25e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131102
Predicted Effect probably damaging
Transcript: ENSMUST00000170248
AA Change: D448G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: D448G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 365 509 1.3e-37 PFAM
Pfam:Cadherin_3 510 623 4.5e-18 PFAM
Pfam:Cadherin_3 593 711 6.1e-16 PFAM
Pfam:Cadherin_3 728 876 2.7e-27 PFAM
Pfam:Cadherin_3 845 991 2.1e-30 PFAM
Pfam:Cadherin_3 1006 1097 4.8e-13 PFAM
Pfam:Cadherin_3 1101 1234 1e-17 PFAM
Pfam:Cadherin_3 1225 1375 6.1e-35 PFAM
Pfam:Cadherin_3 1360 1488 1.5e-22 PFAM
Pfam:Cadherin_3 1488 1598 7.5e-30 PFAM
Pfam:Cadherin_3 1599 1726 1.1e-14 PFAM
Pfam:Calx-beta 1731 1830 6.4e-10 PFAM
low complexity region 1876 1892 N/A INTRINSIC
CLECT 2047 2170 2.25e-27 SMART
Meta Mutation Damage Score 0.8701 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,538,370 R286H possibly damaging Het
Ank3 A T 10: 69,992,944 probably benign Het
Arhgap24 G A 5: 102,552,159 probably null Het
Arhgef2 T C 3: 88,635,869 Y396H probably benign Het
Asap3 G T 4: 136,241,409 G722C probably benign Het
Birc3 A C 9: 7,857,342 *377E probably null Het
Cdc123 G T 2: 5,798,363 Q282K possibly damaging Het
Cdkl4 C T 17: 80,547,691 probably null Het
Cep97 T C 16: 55,905,457 N689S probably benign Het
Cfap97 T G 8: 46,181,858 S407A probably damaging Het
Cfh A T 1: 140,136,229 N436K probably benign Het
Chpf2 A T 5: 24,592,423 probably benign Het
Cnnm2 A G 19: 46,763,177 T469A probably benign Het
Col6a3 T A 1: 90,776,200 I2275F unknown Het
Ctdspl2 A T 2: 121,978,933 N122Y probably damaging Het
Dcaf6 A T 1: 165,351,155 C602S probably benign Het
Dda1 T A 8: 71,474,650 probably benign Het
Dixdc1 T C 9: 50,698,588 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Emilin3 T A 2: 160,909,070 N253I probably damaging Het
Epg5 T A 18: 77,959,632 probably null Het
Fam204a A T 19: 60,221,093 Y68* probably null Het
Fbln5 T G 12: 101,760,743 D329A possibly damaging Het
Fkbp15 T A 4: 62,327,810 probably null Het
Fnbp4 C G 2: 90,774,793 probably benign Het
Foxn2 C A 17: 88,462,710 probably null Het
Fzd9 T C 5: 135,249,345 Y562C probably benign Het
Gcn1l1 A G 5: 115,610,135 silent Het
Gm6003 A G 7: 33,165,266 noncoding transcript Het
Gnl3 C A 14: 31,016,896 E65D possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk2 C T 6: 82,736,634 R461K probably benign Het
Ice1 A G 13: 70,606,377 F530S possibly damaging Het
Ing3 T A 6: 21,968,905 S129T probably benign Het
Ino80 G A 2: 119,458,216 S3L probably damaging Het
Ints2 T A 11: 86,222,174 Q839H probably benign Het
Kcnrg T C 14: 61,611,831 M247T probably benign Het
Kpna6 T C 4: 129,672,692 probably benign Het
Krtap28-13 T A 1: 83,061,323 probably benign Het
Lgr4 T A 2: 109,918,272 V51E possibly damaging Het
Map3k5 A C 10: 20,104,255 E836D probably benign Het
Mapk11 T C 15: 89,145,835 I193V probably benign Het
March10 A T 11: 105,385,482 V660E probably damaging Het
Matn4 T C 2: 164,393,224 E435G probably damaging Het
Mre11a G T 9: 14,811,936 R402M probably damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Ndufv3 C T 17: 31,531,232 R99* probably null Het
Nkx6-1 C T 5: 101,663,981 S85N unknown Het
Nop2 A T 6: 125,134,728 E141D probably benign Het
Olfr1469 A G 19: 13,410,962 H131R probably benign Het
Olfr906 G C 9: 38,488,361 E111Q probably damaging Het
Paox T C 7: 140,129,188 S205P probably damaging Het
Pcdh15 T C 10: 74,630,936 V995A probably benign Het
Pdcd1 T A 1: 94,040,825 K161N probably benign Het
Pfkfb2 C A 1: 130,700,095 V372L probably damaging Het
Phldb1 G A 9: 44,711,651 T19I probably damaging Het
Pik3c2g G T 6: 139,622,479 V198L probably benign Het
Pnpla8 T A 12: 44,295,970 L41* probably null Het
Postn C T 3: 54,373,800 Q449* probably null Het
Ppp1r3a C T 6: 14,718,989 S642N probably benign Het
Ptpn23 G A 9: 110,385,443 probably benign Het
Ptprj T C 2: 90,453,340 N923S possibly damaging Het
Rai1 T C 11: 60,187,804 V898A probably benign Het
Rasgef1a A T 6: 118,080,554 Y72F possibly damaging Het
Serpinb7 T C 1: 107,451,850 V329A probably damaging Het
Slc24a4 T A 12: 102,234,790 I311N probably damaging Het
Slc45a1 C A 4: 150,629,540 L749F possibly damaging Het
Spon1 G A 7: 114,030,821 D428N probably damaging Het
Tcf7l2 G A 19: 55,898,560 E2K probably benign Het
Thoc5 A G 11: 4,920,416 M472V possibly damaging Het
Tm6sf2 T C 8: 70,075,563 Y121H probably damaging Het
Tmc4 T A 7: 3,672,009 D221V probably benign Het
Trim30b A T 7: 104,357,365 S95T probably damaging Het
Trip12 T C 1: 84,763,458 E571G probably damaging Het
Ttn T C 2: 76,951,312 probably null Het
Ubp1 A T 9: 113,956,739 R161W probably benign Het
Usp21 G A 1: 171,282,171 probably benign Het
Vmn1r61 T A 7: 5,610,530 R262W probably damaging Het
Vmn2r67 A T 7: 85,151,836 D297E probably damaging Het
Vwa5a T C 9: 38,741,742 L784S probably benign Het
Vwc2 G A 11: 11,154,244 V259M probably damaging Het
Zeb2 T C 2: 44,997,052 I596M probably benign Het
Zgrf1 T A 3: 127,561,023 L97H probably damaging Het
Other mutations in Frem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Frem1 APN 4 82959389 missense possibly damaging 0.46
IGL01069:Frem1 APN 4 83013867 missense probably benign 0.00
IGL01106:Frem1 APN 4 82922257 missense probably benign 0.00
IGL01398:Frem1 APN 4 82950362 missense possibly damaging 0.64
IGL01617:Frem1 APN 4 82936139 missense probably benign 0.02
IGL01647:Frem1 APN 4 82950356 missense possibly damaging 0.60
IGL01690:Frem1 APN 4 82959296 splice site probably benign
IGL02006:Frem1 APN 4 82992800 critical splice donor site probably null
IGL02069:Frem1 APN 4 82903551 missense probably damaging 1.00
IGL02131:Frem1 APN 4 82924854 missense probably benign 0.03
IGL02225:Frem1 APN 4 82940506 missense probably damaging 1.00
IGL02439:Frem1 APN 4 82956345 missense probably benign 0.00
IGL02567:Frem1 APN 4 83000055 missense probably damaging 1.00
IGL02647:Frem1 APN 4 83001754 missense probably damaging 1.00
IGL02653:Frem1 APN 4 82959334 missense probably benign 0.22
IGL02831:Frem1 APN 4 82956158 missense probably benign 0.31
IGL02997:Frem1 APN 4 82934968 missense probably damaging 1.00
IGL03005:Frem1 APN 4 82994134 missense probably damaging 1.00
IGL03036:Frem1 APN 4 82959339 missense possibly damaging 0.55
IGL03193:Frem1 APN 4 82994026 splice site probably benign
IGL03218:Frem1 APN 4 82914646 missense probably benign 0.00
IGL03235:Frem1 APN 4 83020755 missense possibly damaging 0.87
IGL03243:Frem1 APN 4 83013969 missense probably damaging 1.00
bat UTSW 4 82983060 intron probably benign
R0519_frem1_373 UTSW 4 82970633 critical splice donor site probably null
R1115_Frem1_145 UTSW 4 83020770 missense probably benign 0.28
R4764_Frem1_085 UTSW 4 82989189 missense probably damaging 1.00
R6165_Frem1_083 UTSW 4 82956255 missense probably benign 0.16
R6324_Frem1_643 UTSW 4 82983337 missense probably benign 0.00
PIT4131001:Frem1 UTSW 4 83005808 missense probably damaging 0.99
PIT4466001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4472001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4515001:Frem1 UTSW 4 82900426 missense probably damaging 0.98
PIT4531001:Frem1 UTSW 4 82950280 missense probably benign 0.12
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0115:Frem1 UTSW 4 82936169 missense possibly damaging 0.94
R0125:Frem1 UTSW 4 83011951 missense probably damaging 1.00
R0280:Frem1 UTSW 4 82969444 missense probably damaging 1.00
R0504:Frem1 UTSW 4 82912637 missense probably benign 0.26
R0519:Frem1 UTSW 4 82970633 critical splice donor site probably null
R0631:Frem1 UTSW 4 82972165 missense probably damaging 1.00
R0645:Frem1 UTSW 4 82989166 missense probably damaging 1.00
R0781:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1110:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1115:Frem1 UTSW 4 83020770 missense probably benign 0.28
R1130:Frem1 UTSW 4 82916628 splice site probably null
R1173:Frem1 UTSW 4 82950352 missense probably benign 0.16
R1349:Frem1 UTSW 4 82922305 splice site probably benign
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1658:Frem1 UTSW 4 83001808 missense probably damaging 1.00
R1672:Frem1 UTSW 4 82998891 missense probably benign 0.09
R1831:Frem1 UTSW 4 83020837 missense possibly damaging 0.95
R1851:Frem1 UTSW 4 82950500 missense probably damaging 0.98
R2014:Frem1 UTSW 4 83005852 missense probably damaging 1.00
R2021:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2022:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2023:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2183:Frem1 UTSW 4 82991495 missense probably benign 0.00
R2437:Frem1 UTSW 4 83000173 missense probably damaging 1.00
R2520:Frem1 UTSW 4 82950290 missense probably damaging 0.99
R3195:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3196:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3408:Frem1 UTSW 4 83011986 missense probably damaging 1.00
R3411:Frem1 UTSW 4 82963179 missense possibly damaging 0.51
R3742:Frem1 UTSW 4 83011867 missense probably damaging 1.00
R3829:Frem1 UTSW 4 82998930 missense probably damaging 1.00
R3888:Frem1 UTSW 4 82913607 missense probably benign 0.41
R4329:Frem1 UTSW 4 82986537 missense probably benign 0.01
R4364:Frem1 UTSW 4 82913251 missense probably damaging 0.99
R4411:Frem1 UTSW 4 82963244 missense probably damaging 1.00
R4624:Frem1 UTSW 4 82989106 missense probably damaging 1.00
R4687:Frem1 UTSW 4 83020631 missense probably damaging 1.00
R4764:Frem1 UTSW 4 82989189 missense probably damaging 1.00
R4801:Frem1 UTSW 4 82916628 splice site probably benign
R4802:Frem1 UTSW 4 82916628 splice site probably benign
R4854:Frem1 UTSW 4 82916758 missense possibly damaging 0.88
R4872:Frem1 UTSW 4 82963150 missense probably damaging 1.00
R4947:Frem1 UTSW 4 82966134 missense probably damaging 0.99
R5007:Frem1 UTSW 4 82940812 intron probably benign
R5103:Frem1 UTSW 4 82991612 missense probably benign
R5369:Frem1 UTSW 4 83001739 missense possibly damaging 0.61
R5494:Frem1 UTSW 4 82940753 makesense probably null
R5694:Frem1 UTSW 4 82994116 missense probably damaging 1.00
R5780:Frem1 UTSW 4 82950415 missense probably benign 0.12
R5813:Frem1 UTSW 4 83000158 missense probably damaging 1.00
R5843:Frem1 UTSW 4 82936052 missense probably damaging 1.00
R5985:Frem1 UTSW 4 82966050 missense probably benign
R6091:Frem1 UTSW 4 82900559 missense probably benign 0.01
R6165:Frem1 UTSW 4 82956255 missense probably benign 0.16
R6324:Frem1 UTSW 4 82983337 missense probably benign 0.00
R6369:Frem1 UTSW 4 82913792 splice site probably null
R6414:Frem1 UTSW 4 82940536 missense probably damaging 0.98
R6421:Frem1 UTSW 4 82994128 missense probably damaging 1.00
R6434:Frem1 UTSW 4 82966016 missense probably benign 0.03
R6453:Frem1 UTSW 4 82914825 nonsense probably null
R6598:Frem1 UTSW 4 83013828 missense probably damaging 0.99
R6720:Frem1 UTSW 4 83013832 missense probably damaging 0.98
R6862:Frem1 UTSW 4 83012014 nonsense probably null
R6922:Frem1 UTSW 4 82922269 missense probably damaging 1.00
R6931:Frem1 UTSW 4 82970677 missense probably damaging 1.00
R6992:Frem1 UTSW 4 82940362 missense possibly damaging 0.62
R6995:Frem1 UTSW 4 82986601 missense probably damaging 1.00
R7001:Frem1 UTSW 4 82986561 missense probably benign 0.44
R7104:Frem1 UTSW 4 82940681 missense probably benign 0.30
R7146:Frem1 UTSW 4 82922295 missense possibly damaging 0.93
R7174:Frem1 UTSW 4 82922256 missense probably benign 0.00
R7327:Frem1 UTSW 4 83020755 missense possibly damaging 0.87
R7343:Frem1 UTSW 4 82994122 missense probably damaging 0.99
R7368:Frem1 UTSW 4 82966144 missense probably benign 0.19
R7392:Frem1 UTSW 4 83013827 missense probably benign 0.06
R7465:Frem1 UTSW 4 82914835 missense probably benign 0.11
R7499:Frem1 UTSW 4 83005770 missense probably damaging 1.00
R7536:Frem1 UTSW 4 82956195 missense probably damaging 1.00
R7752:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7753:Frem1 UTSW 4 82913980 missense probably benign 0.03
R7790:Frem1 UTSW 4 82989164 missense probably benign 0.02
R7818:Frem1 UTSW 4 83014008 missense probably damaging 1.00
R7877:Frem1 UTSW 4 83013812 critical splice donor site probably null
R7878:Frem1 UTSW 4 83020680 missense probably benign 0.00
R7886:Frem1 UTSW 4 83016406 missense possibly damaging 0.68
R7901:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7976:Frem1 UTSW 4 83001709 missense probably damaging 0.97
R8240:Frem1 UTSW 4 82956248 missense probably benign 0.21
R8305:Frem1 UTSW 4 82999989 missense probably benign 0.06
R8415:Frem1 UTSW 4 83000262 missense probably damaging 1.00
R8751:Frem1 UTSW 4 82970778 missense probably damaging 1.00
R8819:Frem1 UTSW 4 82903517 missense probably damaging 1.00
R8820:Frem1 UTSW 4 82903517 missense probably damaging 1.00
R8829:Frem1 UTSW 4 83000194 missense probably damaging 1.00
R8834:Frem1 UTSW 4 83004373 missense probably damaging 1.00
X0013:Frem1 UTSW 4 82914808 missense probably benign 0.38
X0017:Frem1 UTSW 4 82991633 critical splice acceptor site probably null
Z1088:Frem1 UTSW 4 82972267 missense probably damaging 1.00
Z1176:Frem1 UTSW 4 82999983 missense probably damaging 1.00
Z1177:Frem1 UTSW 4 82940315 critical splice donor site probably null
Z1177:Frem1 UTSW 4 83000269 missense probably benign 0.39
Z1177:Frem1 UTSW 4 83016464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAAGCATAGGGAAGCAATCTTTC -3'
(R):5'- AGGTAGTTAAGGATGCATCTTAAGG -3'

Sequencing Primer
(F):5'- ACTGATATCTGGACCGCATG -3'
(R):5'- GGATGCATCTTAAGGAATCAATTGTC -3'
Posted On2017-02-28