Incidental Mutation 'R5914:Ppp1r3a'
ID 461187
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Name protein phosphatase 1, regulatory subunit 3A
Synonyms RGL, GM
MMRRC Submission 044111-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5914 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 14713976-14755273 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 14718988 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 642 (S642N)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
AlphaFold Q99MR9
Predicted Effect probably benign
Transcript: ENSMUST00000045096
AA Change: S642N

PolyPhen 2 Score 0.093 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: S642N

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,410,219 (GRCm39) R286H possibly damaging Het
Ank3 A T 10: 69,828,774 (GRCm39) probably benign Het
Arhgap24 G A 5: 102,700,025 (GRCm39) probably null Het
Arhgef2 T C 3: 88,543,176 (GRCm39) Y396H probably benign Het
Asap3 G T 4: 135,968,720 (GRCm39) G722C probably benign Het
Birc2 A C 9: 7,857,343 (GRCm39) *377E probably null Het
Cdc123 G T 2: 5,803,174 (GRCm39) Q282K possibly damaging Het
Cdkl4 C T 17: 80,855,120 (GRCm39) probably null Het
Cep97 T C 16: 55,725,820 (GRCm39) N689S probably benign Het
Cfap97 T G 8: 46,634,895 (GRCm39) S407A probably damaging Het
Cfh A T 1: 140,063,967 (GRCm39) N436K probably benign Het
Chpf2 A T 5: 24,797,421 (GRCm39) probably benign Het
Cnnm2 A G 19: 46,751,616 (GRCm39) T469A probably benign Het
Col6a3 T A 1: 90,703,922 (GRCm39) I2275F unknown Het
Ctdspl2 A T 2: 121,809,414 (GRCm39) N122Y probably damaging Het
Dcaf6 A T 1: 165,178,724 (GRCm39) C602S probably benign Het
Dda1 T A 8: 71,927,294 (GRCm39) probably benign Het
Dixdc1 T C 9: 50,609,888 (GRCm39) probably benign Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Emilin3 T A 2: 160,750,990 (GRCm39) N253I probably damaging Het
Epg5 T A 18: 78,002,847 (GRCm39) probably null Het
Fam204a A T 19: 60,209,525 (GRCm39) Y68* probably null Het
Fbln5 T G 12: 101,727,002 (GRCm39) D329A possibly damaging Het
Fkbp15 T A 4: 62,246,047 (GRCm39) probably null Het
Fnbp4 C G 2: 90,605,137 (GRCm39) probably benign Het
Foxn2 C A 17: 88,770,138 (GRCm39) probably null Het
Frem1 T C 4: 82,920,012 (GRCm39) D448G probably damaging Het
Fzd9 T C 5: 135,278,199 (GRCm39) Y562C probably benign Het
Gcn1 A G 5: 115,748,194 (GRCm39) silent Het
Gm6003 A G 7: 32,864,691 (GRCm39) noncoding transcript Het
Gnl3 C A 14: 30,738,853 (GRCm39) E65D possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,905,247 (GRCm39) probably benign Het
Hk2 C T 6: 82,713,615 (GRCm39) R461K probably benign Het
Ice1 A G 13: 70,754,496 (GRCm39) F530S possibly damaging Het
Ing3 T A 6: 21,968,904 (GRCm39) S129T probably benign Het
Ino80 G A 2: 119,288,697 (GRCm39) S3L probably damaging Het
Ints2 T A 11: 86,113,000 (GRCm39) Q839H probably benign Het
Kcnrg T C 14: 61,849,280 (GRCm39) M247T probably benign Het
Kpna6 T C 4: 129,566,485 (GRCm39) probably benign Het
Krtap28-13 T A 1: 83,039,044 (GRCm39) probably benign Het
Lgr4 T A 2: 109,748,617 (GRCm39) V51E possibly damaging Het
Map3k5 A C 10: 19,980,001 (GRCm39) E836D probably benign Het
Mapk11 T C 15: 89,030,038 (GRCm39) I193V probably benign Het
Marchf10 A T 11: 105,276,308 (GRCm39) V660E probably damaging Het
Matn4 T C 2: 164,235,144 (GRCm39) E435G probably damaging Het
Mre11a G T 9: 14,723,232 (GRCm39) R402M probably damaging Het
Msr1 C T 8: 40,034,868 (GRCm39) G428R probably damaging Het
Ndufv3 C T 17: 31,750,206 (GRCm39) R99* probably null Het
Nkx6-1 C T 5: 101,811,847 (GRCm39) S85N unknown Het
Nop2 A T 6: 125,111,691 (GRCm39) E141D probably benign Het
Or5b3 A G 19: 13,388,326 (GRCm39) H131R probably benign Het
Or8b1 G C 9: 38,399,657 (GRCm39) E111Q probably damaging Het
Paox T C 7: 139,709,101 (GRCm39) S205P probably damaging Het
Pcdh15 T C 10: 74,466,768 (GRCm39) V995A probably benign Het
Pdcd1 T A 1: 93,968,550 (GRCm39) K161N probably benign Het
Pfkfb2 C A 1: 130,627,832 (GRCm39) V372L probably damaging Het
Phldb1 G A 9: 44,622,948 (GRCm39) T19I probably damaging Het
Pik3c2g G T 6: 139,599,477 (GRCm39) V198L probably benign Het
Pnpla8 T A 12: 44,342,753 (GRCm39) L41* probably null Het
Postn C T 3: 54,281,221 (GRCm39) Q449* probably null Het
Ptpn23 G A 9: 110,214,511 (GRCm39) probably benign Het
Ptprj T C 2: 90,283,684 (GRCm39) N923S possibly damaging Het
Rai1 T C 11: 60,078,630 (GRCm39) V898A probably benign Het
Rasgef1a A T 6: 118,057,515 (GRCm39) Y72F possibly damaging Het
Serpinb7 T C 1: 107,379,580 (GRCm39) V329A probably damaging Het
Slc24a4 T A 12: 102,201,049 (GRCm39) I311N probably damaging Het
Slc45a1 C A 4: 150,713,997 (GRCm39) L749F possibly damaging Het
Spon1 G A 7: 113,630,056 (GRCm39) D428N probably damaging Het
Tcf7l2 G A 19: 55,886,992 (GRCm39) E2K probably benign Het
Thoc5 A G 11: 4,870,416 (GRCm39) M472V possibly damaging Het
Tm6sf2 T C 8: 70,528,213 (GRCm39) Y121H probably damaging Het
Tmc4 T A 7: 3,675,008 (GRCm39) D221V probably benign Het
Trim30b A T 7: 104,006,572 (GRCm39) S95T probably damaging Het
Trip12 T C 1: 84,741,179 (GRCm39) E571G probably damaging Het
Ttn T C 2: 76,781,656 (GRCm39) probably null Het
Ubp1 A T 9: 113,785,807 (GRCm39) R161W probably benign Het
Usp21 G A 1: 171,109,745 (GRCm39) probably benign Het
Vmn1r61 T A 7: 5,613,529 (GRCm39) R262W probably damaging Het
Vmn2r67 A T 7: 84,801,044 (GRCm39) D297E probably damaging Het
Vwa5a T C 9: 38,653,038 (GRCm39) L784S probably benign Het
Vwc2 G A 11: 11,104,244 (GRCm39) V259M probably damaging Het
Zeb2 T C 2: 44,887,064 (GRCm39) I596M probably benign Het
Zgrf1 T A 3: 127,354,672 (GRCm39) L97H probably damaging Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14,755,083 (GRCm39) missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14,719,059 (GRCm39) missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14,718,407 (GRCm39) missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14,717,851 (GRCm39) missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14,718,608 (GRCm39) missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14,718,345 (GRCm39) missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14,754,810 (GRCm39) missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14,717,714 (GRCm39) missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14,718,599 (GRCm39) missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14,718,458 (GRCm39) missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14,719,761 (GRCm39) missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14,719,810 (GRCm39) missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14,722,064 (GRCm39) splice site probably benign
IGL03290:Ppp1r3a APN 6 14,754,771 (GRCm39) missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14,719,765 (GRCm39) missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.00
PIT4445001:Ppp1r3a UTSW 6 14,717,776 (GRCm39) missense probably damaging 1.00
R0015:Ppp1r3a UTSW 6 14,717,660 (GRCm39) missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14,754,516 (GRCm39) missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14,718,959 (GRCm39) missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14,719,696 (GRCm39) missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14,754,717 (GRCm39) missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14,717,981 (GRCm39) missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14,754,993 (GRCm39) missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14,718,404 (GRCm39) missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14,722,103 (GRCm39) missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14,721,874 (GRCm39) missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14,718,322 (GRCm39) missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14,719,377 (GRCm39) missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14,718,248 (GRCm39) missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14,719,413 (GRCm39) missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14,719,911 (GRCm39) missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14,719,073 (GRCm39) missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14,719,780 (GRCm39) missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14,754,681 (GRCm39) missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14,718,992 (GRCm39) missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14,719,046 (GRCm39) missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14,754,680 (GRCm39) missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14,719,603 (GRCm39) missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14,719,417 (GRCm39) missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14,719,348 (GRCm39) missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14,719,762 (GRCm39) missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14,719,882 (GRCm39) missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14,718,983 (GRCm39) missense probably benign 0.26
R6091:Ppp1r3a UTSW 6 14,719,339 (GRCm39) missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14,754,603 (GRCm39) missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14,718,430 (GRCm39) missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14,719,570 (GRCm39) missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14,718,980 (GRCm39) nonsense probably null
R6869:Ppp1r3a UTSW 6 14,754,825 (GRCm39) missense probably benign 0.39
R7109:Ppp1r3a UTSW 6 14,719,235 (GRCm39) missense probably benign 0.00
R7188:Ppp1r3a UTSW 6 14,719,190 (GRCm39) missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14,719,069 (GRCm39) missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14,718,749 (GRCm39) missense probably damaging 0.97
R7770:Ppp1r3a UTSW 6 14,754,977 (GRCm39) missense probably benign 0.06
R7856:Ppp1r3a UTSW 6 14,718,025 (GRCm39) missense probably benign 0.01
R8309:Ppp1r3a UTSW 6 14,719,700 (GRCm39) missense probably benign 0.02
R8422:Ppp1r3a UTSW 6 14,718,434 (GRCm39) nonsense probably null
R8868:Ppp1r3a UTSW 6 14,755,014 (GRCm39) missense probably damaging 1.00
R9039:Ppp1r3a UTSW 6 14,754,525 (GRCm39) missense probably damaging 1.00
R9149:Ppp1r3a UTSW 6 14,722,098 (GRCm39) missense probably benign 0.32
R9302:Ppp1r3a UTSW 6 14,721,891 (GRCm39) missense probably benign 0.00
R9399:Ppp1r3a UTSW 6 14,755,010 (GRCm39) missense probably damaging 0.99
R9565:Ppp1r3a UTSW 6 14,719,466 (GRCm39) missense probably benign 0.02
R9730:Ppp1r3a UTSW 6 14,721,923 (GRCm39) missense probably benign 0.25
R9767:Ppp1r3a UTSW 6 14,718,101 (GRCm39) missense probably benign 0.03
R9782:Ppp1r3a UTSW 6 14,718,766 (GRCm39) missense probably damaging 1.00
Z1177:Ppp1r3a UTSW 6 14,755,150 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AGACGCGCTTTCTGGAGTAC -3'
(R):5'- AGAACCAGGAACTAGTGATCTTAG -3'

Sequencing Primer
(F):5'- GTGCTTTCTCAGTAATACCATGATC -3'
(R):5'- AGTTCTCCAAGGAATTTCAGCC -3'
Posted On 2017-02-28