Incidental Mutation 'R5914:Thoc5'
ID461216
Institutional Source Beutler Lab
Gene Symbol Thoc5
Ensembl Gene ENSMUSG00000034274
Gene NameTHO complex 5
Synonyms1700060C24Rik, PK1.3, A430085L24Rik, Fmip
MMRRC Submission 044111-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5914 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location4895320-4928867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4920416 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 472 (M472V)
Ref Sequence ENSEMBL: ENSMUSP00000045580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038237] [ENSMUST00000101615] [ENSMUST00000142543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038237
AA Change: M472V

PolyPhen 2 Score 0.581 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045580
Gene: ENSMUSG00000034274
AA Change: M472V

DomainStartEndE-ValueType
Pfam:FimP 97 452 1.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101615
AA Change: M424V

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099137
Gene: ENSMUSG00000034274
AA Change: M424V

DomainStartEndE-ValueType
low complexity region 34 41 N/A INTRINSIC
Pfam:FimP 48 405 7.5e-142 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121125
Predicted Effect probably benign
Transcript: ENSMUST00000142543
SMART Domains Protein: ENSMUSP00000118940
Gene: ENSMUSG00000034274

DomainStartEndE-ValueType
Pfam:FimP 1 301 1.3e-97 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155872
Meta Mutation Damage Score 0.2368 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 95% (87/92)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,538,370 R286H possibly damaging Het
Ank3 A T 10: 69,992,944 probably benign Het
Arhgap24 G A 5: 102,552,159 probably null Het
Arhgef2 T C 3: 88,635,869 Y396H probably benign Het
Asap3 G T 4: 136,241,409 G722C probably benign Het
Birc3 A C 9: 7,857,342 *377E probably null Het
Cdc123 G T 2: 5,798,363 Q282K possibly damaging Het
Cdkl4 C T 17: 80,547,691 probably null Het
Cep97 T C 16: 55,905,457 N689S probably benign Het
Cfap97 T G 8: 46,181,858 S407A probably damaging Het
Cfh A T 1: 140,136,229 N436K probably benign Het
Chpf2 A T 5: 24,592,423 probably benign Het
Cnnm2 A G 19: 46,763,177 T469A probably benign Het
Col6a3 T A 1: 90,776,200 I2275F unknown Het
Ctdspl2 A T 2: 121,978,933 N122Y probably damaging Het
Dcaf6 A T 1: 165,351,155 C602S probably benign Het
Dda1 T A 8: 71,474,650 probably benign Het
Dixdc1 T C 9: 50,698,588 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Emilin3 T A 2: 160,909,070 N253I probably damaging Het
Epg5 T A 18: 77,959,632 probably null Het
Fam204a A T 19: 60,221,093 Y68* probably null Het
Fbln5 T G 12: 101,760,743 D329A possibly damaging Het
Fkbp15 T A 4: 62,327,810 probably null Het
Fnbp4 C G 2: 90,774,793 probably benign Het
Foxn2 C A 17: 88,462,710 probably null Het
Frem1 T C 4: 83,001,775 D448G probably damaging Het
Fzd9 T C 5: 135,249,345 Y562C probably benign Het
Gcn1l1 A G 5: 115,610,135 silent Het
Gm6003 A G 7: 33,165,266 noncoding transcript Het
Gnl3 C A 14: 31,016,896 E65D possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk2 C T 6: 82,736,634 R461K probably benign Het
Ice1 A G 13: 70,606,377 F530S possibly damaging Het
Ing3 T A 6: 21,968,905 S129T probably benign Het
Ino80 G A 2: 119,458,216 S3L probably damaging Het
Ints2 T A 11: 86,222,174 Q839H probably benign Het
Kcnrg T C 14: 61,611,831 M247T probably benign Het
Kpna6 T C 4: 129,672,692 probably benign Het
Krtap28-13 T A 1: 83,061,323 probably benign Het
Lgr4 T A 2: 109,918,272 V51E possibly damaging Het
Map3k5 A C 10: 20,104,255 E836D probably benign Het
Mapk11 T C 15: 89,145,835 I193V probably benign Het
March10 A T 11: 105,385,482 V660E probably damaging Het
Matn4 T C 2: 164,393,224 E435G probably damaging Het
Mre11a G T 9: 14,811,936 R402M probably damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Ndufv3 C T 17: 31,531,232 R99* probably null Het
Nkx6-1 C T 5: 101,663,981 S85N unknown Het
Nop2 A T 6: 125,134,728 E141D probably benign Het
Olfr1469 A G 19: 13,410,962 H131R probably benign Het
Olfr906 G C 9: 38,488,361 E111Q probably damaging Het
Paox T C 7: 140,129,188 S205P probably damaging Het
Pcdh15 T C 10: 74,630,936 V995A probably benign Het
Pdcd1 T A 1: 94,040,825 K161N probably benign Het
Pfkfb2 C A 1: 130,700,095 V372L probably damaging Het
Phldb1 G A 9: 44,711,651 T19I probably damaging Het
Pik3c2g G T 6: 139,622,479 V198L probably benign Het
Pnpla8 T A 12: 44,295,970 L41* probably null Het
Postn C T 3: 54,373,800 Q449* probably null Het
Ppp1r3a C T 6: 14,718,989 S642N probably benign Het
Ptpn23 G A 9: 110,385,443 probably benign Het
Ptprj T C 2: 90,453,340 N923S possibly damaging Het
Rai1 T C 11: 60,187,804 V898A probably benign Het
Rasgef1a A T 6: 118,080,554 Y72F possibly damaging Het
Serpinb7 T C 1: 107,451,850 V329A probably damaging Het
Slc24a4 T A 12: 102,234,790 I311N probably damaging Het
Slc45a1 C A 4: 150,629,540 L749F possibly damaging Het
Spon1 G A 7: 114,030,821 D428N probably damaging Het
Tcf7l2 G A 19: 55,898,560 E2K probably benign Het
Tm6sf2 T C 8: 70,075,563 Y121H probably damaging Het
Tmc4 T A 7: 3,672,009 D221V probably benign Het
Trim30b A T 7: 104,357,365 S95T probably damaging Het
Trip12 T C 1: 84,763,458 E571G probably damaging Het
Ttn T C 2: 76,951,312 probably null Het
Ubp1 A T 9: 113,956,739 R161W probably benign Het
Usp21 G A 1: 171,282,171 probably benign Het
Vmn1r61 T A 7: 5,610,530 R262W probably damaging Het
Vmn2r67 A T 7: 85,151,836 D297E probably damaging Het
Vwa5a T C 9: 38,741,742 L784S probably benign Het
Vwc2 G A 11: 11,154,244 V259M probably damaging Het
Zeb2 T C 2: 44,997,052 I596M probably benign Het
Zgrf1 T A 3: 127,561,023 L97H probably damaging Het
Other mutations in Thoc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Thoc5 APN 11 4918147 missense probably damaging 0.96
IGL02039:Thoc5 APN 11 4922027 critical splice donor site probably null
IGL02227:Thoc5 APN 11 4926217 missense probably benign 0.02
IGL02970:Thoc5 APN 11 4904201 missense probably damaging 0.99
R0398:Thoc5 UTSW 11 4921978 missense possibly damaging 0.84
R0401:Thoc5 UTSW 11 4902213 utr 5 prime probably benign
R0453:Thoc5 UTSW 11 4918217 missense possibly damaging 0.60
R1223:Thoc5 UTSW 11 4921922 missense probably benign 0.40
R1438:Thoc5 UTSW 11 4911427 splice site probably benign
R1661:Thoc5 UTSW 11 4919792 missense probably benign 0.04
R1665:Thoc5 UTSW 11 4919792 missense probably benign 0.04
R1776:Thoc5 UTSW 11 4914517 splice site probably benign
R1830:Thoc5 UTSW 11 4914608 missense probably benign 0.02
R1912:Thoc5 UTSW 11 4915561 missense probably benign 0.15
R3001:Thoc5 UTSW 11 4928688 missense probably benign
R3002:Thoc5 UTSW 11 4928688 missense probably benign
R3783:Thoc5 UTSW 11 4920372 unclassified probably benign
R4534:Thoc5 UTSW 11 4924807 nonsense probably null
R4619:Thoc5 UTSW 11 4926218 missense probably damaging 0.96
R4747:Thoc5 UTSW 11 4904187 missense probably damaging 0.99
R5106:Thoc5 UTSW 11 4910630 missense probably damaging 1.00
R5310:Thoc5 UTSW 11 4910648 missense probably damaging 1.00
R5936:Thoc5 UTSW 11 4904133 missense probably damaging 1.00
R6167:Thoc5 UTSW 11 4915497 missense probably benign 0.12
R6209:Thoc5 UTSW 11 4905697 missense probably damaging 1.00
R6243:Thoc5 UTSW 11 4919753 missense possibly damaging 0.59
R6504:Thoc5 UTSW 11 4924815 nonsense probably null
R6833:Thoc5 UTSW 11 4919804 missense probably damaging 1.00
R6874:Thoc5 UTSW 11 4901261 missense probably damaging 1.00
R7048:Thoc5 UTSW 11 4926237 critical splice donor site probably null
R7197:Thoc5 UTSW 11 4915563 missense probably benign 0.01
R7753:Thoc5 UTSW 11 4902156 missense probably damaging 0.99
R7828:Thoc5 UTSW 11 4902306 start gained probably benign
R8416:Thoc5 UTSW 11 4926068 missense probably benign 0.41
R8428:Thoc5 UTSW 11 4926115 missense probably damaging 0.99
R8673:Thoc5 UTSW 11 4926061 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- AGGGCTTAGCATTTTACCTGATC -3'
(R):5'- CCAATGCTCAGTAAGGCCAG -3'

Sequencing Primer
(F):5'- TACCTGATCTAGTGGGCCAAC -3'
(R):5'- CAGGAACACAGGTCTCTTTGATC -3'
Posted On2017-02-28