Incidental Mutation 'R5914:Ints2'
ID 461220
Institutional Source Beutler Lab
Gene Symbol Ints2
Ensembl Gene ENSMUSG00000018068
Gene Name integrator complex subunit 2
Synonyms 2810417D08Rik
MMRRC Submission 044111-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5914 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 86101507-86148401 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86113000 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 839 (Q839H)
Ref Sequence ENSEMBL: ENSMUSP00000103674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]
AlphaFold Q80UK8
Predicted Effect probably benign
Transcript: ENSMUST00000018212
AA Change: Q839H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: Q839H

DomainStartEndE-ValueType
Pfam:INTS2 24 1131 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108039
AA Change: Q839H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: Q839H

DomainStartEndE-ValueType
Pfam:INTS2 24 1132 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146421
Meta Mutation Damage Score 0.0573 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,410,219 (GRCm39) R286H possibly damaging Het
Ank3 A T 10: 69,828,774 (GRCm39) probably benign Het
Arhgap24 G A 5: 102,700,025 (GRCm39) probably null Het
Arhgef2 T C 3: 88,543,176 (GRCm39) Y396H probably benign Het
Asap3 G T 4: 135,968,720 (GRCm39) G722C probably benign Het
Birc2 A C 9: 7,857,343 (GRCm39) *377E probably null Het
Cdc123 G T 2: 5,803,174 (GRCm39) Q282K possibly damaging Het
Cdkl4 C T 17: 80,855,120 (GRCm39) probably null Het
Cep97 T C 16: 55,725,820 (GRCm39) N689S probably benign Het
Cfap97 T G 8: 46,634,895 (GRCm39) S407A probably damaging Het
Cfh A T 1: 140,063,967 (GRCm39) N436K probably benign Het
Chpf2 A T 5: 24,797,421 (GRCm39) probably benign Het
Cnnm2 A G 19: 46,751,616 (GRCm39) T469A probably benign Het
Col6a3 T A 1: 90,703,922 (GRCm39) I2275F unknown Het
Ctdspl2 A T 2: 121,809,414 (GRCm39) N122Y probably damaging Het
Dcaf6 A T 1: 165,178,724 (GRCm39) C602S probably benign Het
Dda1 T A 8: 71,927,294 (GRCm39) probably benign Het
Dixdc1 T C 9: 50,609,888 (GRCm39) probably benign Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Emilin3 T A 2: 160,750,990 (GRCm39) N253I probably damaging Het
Epg5 T A 18: 78,002,847 (GRCm39) probably null Het
Fam204a A T 19: 60,209,525 (GRCm39) Y68* probably null Het
Fbln5 T G 12: 101,727,002 (GRCm39) D329A possibly damaging Het
Fkbp15 T A 4: 62,246,047 (GRCm39) probably null Het
Fnbp4 C G 2: 90,605,137 (GRCm39) probably benign Het
Foxn2 C A 17: 88,770,138 (GRCm39) probably null Het
Frem1 T C 4: 82,920,012 (GRCm39) D448G probably damaging Het
Fzd9 T C 5: 135,278,199 (GRCm39) Y562C probably benign Het
Gcn1 A G 5: 115,748,194 (GRCm39) silent Het
Gm6003 A G 7: 32,864,691 (GRCm39) noncoding transcript Het
Gnl3 C A 14: 30,738,853 (GRCm39) E65D possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,905,247 (GRCm39) probably benign Het
Hk2 C T 6: 82,713,615 (GRCm39) R461K probably benign Het
Ice1 A G 13: 70,754,496 (GRCm39) F530S possibly damaging Het
Ing3 T A 6: 21,968,904 (GRCm39) S129T probably benign Het
Ino80 G A 2: 119,288,697 (GRCm39) S3L probably damaging Het
Kcnrg T C 14: 61,849,280 (GRCm39) M247T probably benign Het
Kpna6 T C 4: 129,566,485 (GRCm39) probably benign Het
Krtap28-13 T A 1: 83,039,044 (GRCm39) probably benign Het
Lgr4 T A 2: 109,748,617 (GRCm39) V51E possibly damaging Het
Map3k5 A C 10: 19,980,001 (GRCm39) E836D probably benign Het
Mapk11 T C 15: 89,030,038 (GRCm39) I193V probably benign Het
Marchf10 A T 11: 105,276,308 (GRCm39) V660E probably damaging Het
Matn4 T C 2: 164,235,144 (GRCm39) E435G probably damaging Het
Mre11a G T 9: 14,723,232 (GRCm39) R402M probably damaging Het
Msr1 C T 8: 40,034,868 (GRCm39) G428R probably damaging Het
Ndufv3 C T 17: 31,750,206 (GRCm39) R99* probably null Het
Nkx6-1 C T 5: 101,811,847 (GRCm39) S85N unknown Het
Nop2 A T 6: 125,111,691 (GRCm39) E141D probably benign Het
Or5b3 A G 19: 13,388,326 (GRCm39) H131R probably benign Het
Or8b1 G C 9: 38,399,657 (GRCm39) E111Q probably damaging Het
Paox T C 7: 139,709,101 (GRCm39) S205P probably damaging Het
Pcdh15 T C 10: 74,466,768 (GRCm39) V995A probably benign Het
Pdcd1 T A 1: 93,968,550 (GRCm39) K161N probably benign Het
Pfkfb2 C A 1: 130,627,832 (GRCm39) V372L probably damaging Het
Phldb1 G A 9: 44,622,948 (GRCm39) T19I probably damaging Het
Pik3c2g G T 6: 139,599,477 (GRCm39) V198L probably benign Het
Pnpla8 T A 12: 44,342,753 (GRCm39) L41* probably null Het
Postn C T 3: 54,281,221 (GRCm39) Q449* probably null Het
Ppp1r3a C T 6: 14,718,988 (GRCm39) S642N probably benign Het
Ptpn23 G A 9: 110,214,511 (GRCm39) probably benign Het
Ptprj T C 2: 90,283,684 (GRCm39) N923S possibly damaging Het
Rai1 T C 11: 60,078,630 (GRCm39) V898A probably benign Het
Rasgef1a A T 6: 118,057,515 (GRCm39) Y72F possibly damaging Het
Serpinb7 T C 1: 107,379,580 (GRCm39) V329A probably damaging Het
Slc24a4 T A 12: 102,201,049 (GRCm39) I311N probably damaging Het
Slc45a1 C A 4: 150,713,997 (GRCm39) L749F possibly damaging Het
Spon1 G A 7: 113,630,056 (GRCm39) D428N probably damaging Het
Tcf7l2 G A 19: 55,886,992 (GRCm39) E2K probably benign Het
Thoc5 A G 11: 4,870,416 (GRCm39) M472V possibly damaging Het
Tm6sf2 T C 8: 70,528,213 (GRCm39) Y121H probably damaging Het
Tmc4 T A 7: 3,675,008 (GRCm39) D221V probably benign Het
Trim30b A T 7: 104,006,572 (GRCm39) S95T probably damaging Het
Trip12 T C 1: 84,741,179 (GRCm39) E571G probably damaging Het
Ttn T C 2: 76,781,656 (GRCm39) probably null Het
Ubp1 A T 9: 113,785,807 (GRCm39) R161W probably benign Het
Usp21 G A 1: 171,109,745 (GRCm39) probably benign Het
Vmn1r61 T A 7: 5,613,529 (GRCm39) R262W probably damaging Het
Vmn2r67 A T 7: 84,801,044 (GRCm39) D297E probably damaging Het
Vwa5a T C 9: 38,653,038 (GRCm39) L784S probably benign Het
Vwc2 G A 11: 11,104,244 (GRCm39) V259M probably damaging Het
Zeb2 T C 2: 44,887,064 (GRCm39) I596M probably benign Het
Zgrf1 T A 3: 127,354,672 (GRCm39) L97H probably damaging Het
Other mutations in Ints2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Ints2 APN 11 86,123,961 (GRCm39) missense probably damaging 1.00
IGL02490:Ints2 APN 11 86,124,009 (GRCm39) missense possibly damaging 0.93
IGL02612:Ints2 APN 11 86,106,404 (GRCm39) missense probably damaging 1.00
IGL03396:Ints2 APN 11 86,103,888 (GRCm39) missense probably damaging 0.99
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0015:Ints2 UTSW 11 86,140,113 (GRCm39) missense probably damaging 1.00
R0355:Ints2 UTSW 11 86,125,575 (GRCm39) missense probably benign 0.00
R0389:Ints2 UTSW 11 86,139,677 (GRCm39) missense probably damaging 1.00
R0631:Ints2 UTSW 11 86,124,022 (GRCm39) missense probably benign 0.02
R0944:Ints2 UTSW 11 86,135,289 (GRCm39) missense possibly damaging 0.85
R1268:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1269:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1270:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1396:Ints2 UTSW 11 86,140,074 (GRCm39) missense probably damaging 0.98
R1474:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1503:Ints2 UTSW 11 86,117,607 (GRCm39) missense probably damaging 0.97
R1840:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R1987:Ints2 UTSW 11 86,108,626 (GRCm39) missense probably benign 0.03
R1990:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R1991:Ints2 UTSW 11 86,139,760 (GRCm39) missense possibly damaging 0.58
R3694:Ints2 UTSW 11 86,133,827 (GRCm39) missense probably benign 0.41
R4056:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4057:Ints2 UTSW 11 86,133,778 (GRCm39) missense probably damaging 1.00
R4569:Ints2 UTSW 11 86,147,024 (GRCm39) missense probably damaging 1.00
R4585:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4586:Ints2 UTSW 11 86,140,101 (GRCm39) missense probably damaging 1.00
R4806:Ints2 UTSW 11 86,147,035 (GRCm39) missense probably benign 0.10
R4929:Ints2 UTSW 11 86,103,479 (GRCm39) missense possibly damaging 0.56
R5031:Ints2 UTSW 11 86,147,026 (GRCm39) missense probably damaging 1.00
R5064:Ints2 UTSW 11 86,140,100 (GRCm39) missense probably damaging 1.00
R5270:Ints2 UTSW 11 86,106,621 (GRCm39) missense probably damaging 1.00
R5621:Ints2 UTSW 11 86,133,773 (GRCm39) missense probably benign 0.32
R5875:Ints2 UTSW 11 86,129,138 (GRCm39) missense probably benign 0.04
R5908:Ints2 UTSW 11 86,106,371 (GRCm39) critical splice donor site probably null
R5941:Ints2 UTSW 11 86,141,798 (GRCm39) missense probably benign 0.01
R5975:Ints2 UTSW 11 86,117,574 (GRCm39) missense possibly damaging 0.72
R6003:Ints2 UTSW 11 86,129,294 (GRCm39) missense probably damaging 1.00
R6091:Ints2 UTSW 11 86,127,429 (GRCm39) missense probably damaging 0.96
R6209:Ints2 UTSW 11 86,115,884 (GRCm39) missense probably damaging 1.00
R6567:Ints2 UTSW 11 86,117,487 (GRCm39) missense probably benign 0.42
R6764:Ints2 UTSW 11 86,103,605 (GRCm39) missense probably benign 0.00
R7033:Ints2 UTSW 11 86,123,911 (GRCm39) missense probably damaging 1.00
R7132:Ints2 UTSW 11 86,108,580 (GRCm39) missense probably benign 0.26
R7337:Ints2 UTSW 11 86,108,668 (GRCm39) missense probably benign 0.00
R7410:Ints2 UTSW 11 86,124,052 (GRCm39) missense probably benign 0.02
R7483:Ints2 UTSW 11 86,106,444 (GRCm39) missense probably damaging 1.00
R7503:Ints2 UTSW 11 86,122,881 (GRCm39) missense probably benign
R7804:Ints2 UTSW 11 86,103,489 (GRCm39) missense possibly damaging 0.92
R7845:Ints2 UTSW 11 86,129,089 (GRCm39) missense possibly damaging 0.93
R7875:Ints2 UTSW 11 86,103,888 (GRCm39) missense probably damaging 0.99
R7918:Ints2 UTSW 11 86,113,043 (GRCm39) missense probably damaging 1.00
R7922:Ints2 UTSW 11 86,135,453 (GRCm39) missense probably benign 0.29
R8058:Ints2 UTSW 11 86,146,179 (GRCm39) missense probably benign 0.05
R8134:Ints2 UTSW 11 86,103,486 (GRCm39) missense probably damaging 1.00
R8189:Ints2 UTSW 11 86,106,396 (GRCm39) missense probably damaging 1.00
R8295:Ints2 UTSW 11 86,115,914 (GRCm39) missense probably damaging 0.97
R8348:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8448:Ints2 UTSW 11 86,146,249 (GRCm39) missense probably benign
R8784:Ints2 UTSW 11 86,115,941 (GRCm39) nonsense probably null
R8784:Ints2 UTSW 11 86,112,963 (GRCm39) missense probably damaging 1.00
R8942:Ints2 UTSW 11 86,103,720 (GRCm39) missense probably benign 0.00
R9037:Ints2 UTSW 11 86,106,530 (GRCm39) missense probably benign
R9154:Ints2 UTSW 11 86,125,524 (GRCm39) missense probably damaging 1.00
R9397:Ints2 UTSW 11 86,135,311 (GRCm39) missense probably benign 0.01
R9412:Ints2 UTSW 11 86,117,589 (GRCm39) missense probably damaging 0.99
R9472:Ints2 UTSW 11 86,133,824 (GRCm39) missense
R9476:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
R9510:Ints2 UTSW 11 86,135,335 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCTCAGTGGGTTAGAGCA -3'
(R):5'- CAGCCTGAAATACATGAGAGCCT -3'

Sequencing Primer
(F):5'- TCTGAAGACAGCTACAGTGTAC -3'
(R):5'- TCACTAGGCTGTGGGTAA -3'
Posted On 2017-02-28