Mutagenetix > Incidental Mutations

Incidental Mutation 'R5914:Ints2'

461220

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

044111-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5914 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 86222174 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 839 (Q839H)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: Q839H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: Q839H

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: Q839H

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: Q839H

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000134828

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146421

Meta Mutation Damage Score

0.0573

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

95% (87/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	G	A	15: 74,538,370	R286H	possibly damaging	Het
Ank3	A	T	10: 69,992,944		probably benign	Het
Arhgap24	G	A	5: 102,552,159		probably null	Het
Arhgef2	T	C	3: 88,635,869	Y396H	probably benign	Het
Asap3	G	T	4: 136,241,409	G722C	probably benign	Het
Birc3	A	C	9: 7,857,342	*377E	probably null	Het
Cdc123	G	T	2: 5,798,363	Q282K	possibly damaging	Het
Cdkl4	C	T	17: 80,547,691		probably null	Het
Cep97	T	C	16: 55,905,457	N689S	probably benign	Het
Cfap97	T	G	8: 46,181,858	S407A	probably damaging	Het
Cfh	A	T	1: 140,136,229	N436K	probably benign	Het
Chpf2	A	T	5: 24,592,423		probably benign	Het
Cnnm2	A	G	19: 46,763,177	T469A	probably benign	Het
Col6a3	T	A	1: 90,776,200	I2275F	unknown	Het
Ctdspl2	A	T	2: 121,978,933	N122Y	probably damaging	Het
Dcaf6	A	T	1: 165,351,155	C602S	probably benign	Het
Dda1	T	A	8: 71,474,650		probably benign	Het
Dixdc1	T	C	9: 50,698,588		probably benign	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Emilin3	T	A	2: 160,909,070	N253I	probably damaging	Het
Epg5	T	A	18: 77,959,632		probably null	Het
Fam204a	A	T	19: 60,221,093	Y68*	probably null	Het
Fbln5	T	G	12: 101,760,743	D329A	possibly damaging	Het
Fkbp15	T	A	4: 62,327,810		probably null	Het
Fnbp4	C	G	2: 90,774,793		probably benign	Het
Foxn2	C	A	17: 88,462,710		probably null	Het
Frem1	T	C	4: 83,001,775	D448G	probably damaging	Het
Fzd9	T	C	5: 135,249,345	Y562C	probably benign	Het
Gcn1l1	A	G	5: 115,610,135		silent	Het
Gm6003	A	G	7: 33,165,266		noncoding transcript	Het
Gnl3	C	A	14: 31,016,896	E65D	possibly damaging	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Hk2	C	T	6: 82,736,634	R461K	probably benign	Het
Ice1	A	G	13: 70,606,377	F530S	possibly damaging	Het
Ing3	T	A	6: 21,968,905	S129T	probably benign	Het
Ino80	G	A	2: 119,458,216	S3L	probably damaging	Het
Kcnrg	T	C	14: 61,611,831	M247T	probably benign	Het
Kpna6	T	C	4: 129,672,692		probably benign	Het
Krtap28-13	T	A	1: 83,061,323		probably benign	Het
Lgr4	T	A	2: 109,918,272	V51E	possibly damaging	Het
Map3k5	A	C	10: 20,104,255	E836D	probably benign	Het
Mapk11	T	C	15: 89,145,835	I193V	probably benign	Het
March10	A	T	11: 105,385,482	V660E	probably damaging	Het
Matn4	T	C	2: 164,393,224	E435G	probably damaging	Het
Mre11a	G	T	9: 14,811,936	R402M	probably damaging	Het
Msr1	C	T	8: 39,581,827	G428R	probably damaging	Het
Ndufv3	C	T	17: 31,531,232	R99*	probably null	Het
Nkx6-1	C	T	5: 101,663,981	S85N	unknown	Het
Nop2	A	T	6: 125,134,728	E141D	probably benign	Het
Olfr1469	A	G	19: 13,410,962	H131R	probably benign	Het
Olfr906	G	C	9: 38,488,361	E111Q	probably damaging	Het
Paox	T	C	7: 140,129,188	S205P	probably damaging	Het
Pcdh15	T	C	10: 74,630,936	V995A	probably benign	Het
Pdcd1	T	A	1: 94,040,825	K161N	probably benign	Het
Pfkfb2	C	A	1: 130,700,095	V372L	probably damaging	Het
Phldb1	G	A	9: 44,711,651	T19I	probably damaging	Het
Pik3c2g	G	T	6: 139,622,479	V198L	probably benign	Het
Pnpla8	T	A	12: 44,295,970	L41*	probably null	Het
Postn	C	T	3: 54,373,800	Q449*	probably null	Het
Ppp1r3a	C	T	6: 14,718,989	S642N	probably benign	Het
Ptpn23	G	A	9: 110,385,443		probably benign	Het
Ptprj	T	C	2: 90,453,340	N923S	possibly damaging	Het
Rai1	T	C	11: 60,187,804	V898A	probably benign	Het
Rasgef1a	A	T	6: 118,080,554	Y72F	possibly damaging	Het
Serpinb7	T	C	1: 107,451,850	V329A	probably damaging	Het
Slc24a4	T	A	12: 102,234,790	I311N	probably damaging	Het
Slc45a1	C	A	4: 150,629,540	L749F	possibly damaging	Het
Spon1	G	A	7: 114,030,821	D428N	probably damaging	Het
Tcf7l2	G	A	19: 55,898,560	E2K	probably benign	Het
Thoc5	A	G	11: 4,920,416	M472V	possibly damaging	Het
Tm6sf2	T	C	8: 70,075,563	Y121H	probably damaging	Het
Tmc4	T	A	7: 3,672,009	D221V	probably benign	Het
Trim30b	A	T	7: 104,357,365	S95T	probably damaging	Het
Trip12	T	C	1: 84,763,458	E571G	probably damaging	Het
Ttn	T	C	2: 76,951,312		probably null	Het
Ubp1	A	T	9: 113,956,739	R161W	probably benign	Het
Usp21	G	A	1: 171,282,171		probably benign	Het
Vmn1r61	T	A	7: 5,610,530	R262W	probably damaging	Het
Vmn2r67	A	T	7: 85,151,836	D297E	probably damaging	Het
Vwa5a	T	C	9: 38,741,742	L784S	probably benign	Het
Vwc2	G	A	11: 11,154,244	V259M	probably damaging	Het
Zeb2	T	C	2: 44,997,052	I596M	probably benign	Het
Zgrf1	T	A	3: 127,561,023	L97H	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R3694:Ints2	UTSW	11	86243001	missense	probably benign	0.41
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGCTCAGTGGGTTAGAGCA -3'
(R):5'- CAGCCTGAAATACATGAGAGCCT -3'

Sequencing Primer
(F):5'- TCTGAAGACAGCTACAGTGTAC -3'
(R):5'- TCACTAGGCTGTGGGTAA -3'

Posted On

2017-02-28