Incidental Mutation 'R5914:Ice1'
ID 461225
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
MMRRC Submission 044111-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.946) question?
Stock # R5914 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 70736808-70785958 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70754496 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 530 (F530S)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637] [ENSMUST00000222568]
AlphaFold E9Q286
Predicted Effect possibly damaging
Transcript: ENSMUST00000043493
AA Change: F530S

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: F530S

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect probably benign
Transcript: ENSMUST00000222568
Predicted Effect probably benign
Transcript: ENSMUST00000222627
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 95% (87/92)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,410,219 (GRCm39) R286H possibly damaging Het
Ank3 A T 10: 69,828,774 (GRCm39) probably benign Het
Arhgap24 G A 5: 102,700,025 (GRCm39) probably null Het
Arhgef2 T C 3: 88,543,176 (GRCm39) Y396H probably benign Het
Asap3 G T 4: 135,968,720 (GRCm39) G722C probably benign Het
Birc2 A C 9: 7,857,343 (GRCm39) *377E probably null Het
Cdc123 G T 2: 5,803,174 (GRCm39) Q282K possibly damaging Het
Cdkl4 C T 17: 80,855,120 (GRCm39) probably null Het
Cep97 T C 16: 55,725,820 (GRCm39) N689S probably benign Het
Cfap97 T G 8: 46,634,895 (GRCm39) S407A probably damaging Het
Cfh A T 1: 140,063,967 (GRCm39) N436K probably benign Het
Chpf2 A T 5: 24,797,421 (GRCm39) probably benign Het
Cnnm2 A G 19: 46,751,616 (GRCm39) T469A probably benign Het
Col6a3 T A 1: 90,703,922 (GRCm39) I2275F unknown Het
Ctdspl2 A T 2: 121,809,414 (GRCm39) N122Y probably damaging Het
Dcaf6 A T 1: 165,178,724 (GRCm39) C602S probably benign Het
Dda1 T A 8: 71,927,294 (GRCm39) probably benign Het
Dixdc1 T C 9: 50,609,888 (GRCm39) probably benign Het
Dnah2 C T 11: 69,349,746 (GRCm39) R2399Q probably benign Het
Emilin3 T A 2: 160,750,990 (GRCm39) N253I probably damaging Het
Epg5 T A 18: 78,002,847 (GRCm39) probably null Het
Fam204a A T 19: 60,209,525 (GRCm39) Y68* probably null Het
Fbln5 T G 12: 101,727,002 (GRCm39) D329A possibly damaging Het
Fkbp15 T A 4: 62,246,047 (GRCm39) probably null Het
Fnbp4 C G 2: 90,605,137 (GRCm39) probably benign Het
Foxn2 C A 17: 88,770,138 (GRCm39) probably null Het
Frem1 T C 4: 82,920,012 (GRCm39) D448G probably damaging Het
Fzd9 T C 5: 135,278,199 (GRCm39) Y562C probably benign Het
Gcn1 A G 5: 115,748,194 (GRCm39) silent Het
Gm6003 A G 7: 32,864,691 (GRCm39) noncoding transcript Het
Gnl3 C A 14: 30,738,853 (GRCm39) E65D possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,905,247 (GRCm39) probably benign Het
Hk2 C T 6: 82,713,615 (GRCm39) R461K probably benign Het
Ing3 T A 6: 21,968,904 (GRCm39) S129T probably benign Het
Ino80 G A 2: 119,288,697 (GRCm39) S3L probably damaging Het
Ints2 T A 11: 86,113,000 (GRCm39) Q839H probably benign Het
Kcnrg T C 14: 61,849,280 (GRCm39) M247T probably benign Het
Kpna6 T C 4: 129,566,485 (GRCm39) probably benign Het
Krtap28-13 T A 1: 83,039,044 (GRCm39) probably benign Het
Lgr4 T A 2: 109,748,617 (GRCm39) V51E possibly damaging Het
Map3k5 A C 10: 19,980,001 (GRCm39) E836D probably benign Het
Mapk11 T C 15: 89,030,038 (GRCm39) I193V probably benign Het
Marchf10 A T 11: 105,276,308 (GRCm39) V660E probably damaging Het
Matn4 T C 2: 164,235,144 (GRCm39) E435G probably damaging Het
Mre11a G T 9: 14,723,232 (GRCm39) R402M probably damaging Het
Msr1 C T 8: 40,034,868 (GRCm39) G428R probably damaging Het
Ndufv3 C T 17: 31,750,206 (GRCm39) R99* probably null Het
Nkx6-1 C T 5: 101,811,847 (GRCm39) S85N unknown Het
Nop2 A T 6: 125,111,691 (GRCm39) E141D probably benign Het
Or5b3 A G 19: 13,388,326 (GRCm39) H131R probably benign Het
Or8b1 G C 9: 38,399,657 (GRCm39) E111Q probably damaging Het
Paox T C 7: 139,709,101 (GRCm39) S205P probably damaging Het
Pcdh15 T C 10: 74,466,768 (GRCm39) V995A probably benign Het
Pdcd1 T A 1: 93,968,550 (GRCm39) K161N probably benign Het
Pfkfb2 C A 1: 130,627,832 (GRCm39) V372L probably damaging Het
Phldb1 G A 9: 44,622,948 (GRCm39) T19I probably damaging Het
Pik3c2g G T 6: 139,599,477 (GRCm39) V198L probably benign Het
Pnpla8 T A 12: 44,342,753 (GRCm39) L41* probably null Het
Postn C T 3: 54,281,221 (GRCm39) Q449* probably null Het
Ppp1r3a C T 6: 14,718,988 (GRCm39) S642N probably benign Het
Ptpn23 G A 9: 110,214,511 (GRCm39) probably benign Het
Ptprj T C 2: 90,283,684 (GRCm39) N923S possibly damaging Het
Rai1 T C 11: 60,078,630 (GRCm39) V898A probably benign Het
Rasgef1a A T 6: 118,057,515 (GRCm39) Y72F possibly damaging Het
Serpinb7 T C 1: 107,379,580 (GRCm39) V329A probably damaging Het
Slc24a4 T A 12: 102,201,049 (GRCm39) I311N probably damaging Het
Slc45a1 C A 4: 150,713,997 (GRCm39) L749F possibly damaging Het
Spon1 G A 7: 113,630,056 (GRCm39) D428N probably damaging Het
Tcf7l2 G A 19: 55,886,992 (GRCm39) E2K probably benign Het
Thoc5 A G 11: 4,870,416 (GRCm39) M472V possibly damaging Het
Tm6sf2 T C 8: 70,528,213 (GRCm39) Y121H probably damaging Het
Tmc4 T A 7: 3,675,008 (GRCm39) D221V probably benign Het
Trim30b A T 7: 104,006,572 (GRCm39) S95T probably damaging Het
Trip12 T C 1: 84,741,179 (GRCm39) E571G probably damaging Het
Ttn T C 2: 76,781,656 (GRCm39) probably null Het
Ubp1 A T 9: 113,785,807 (GRCm39) R161W probably benign Het
Usp21 G A 1: 171,109,745 (GRCm39) probably benign Het
Vmn1r61 T A 7: 5,613,529 (GRCm39) R262W probably damaging Het
Vmn2r67 A T 7: 84,801,044 (GRCm39) D297E probably damaging Het
Vwa5a T C 9: 38,653,038 (GRCm39) L784S probably benign Het
Vwc2 G A 11: 11,104,244 (GRCm39) V259M probably damaging Het
Zeb2 T C 2: 44,887,064 (GRCm39) I596M probably benign Het
Zgrf1 T A 3: 127,354,672 (GRCm39) L97H probably damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70,750,408 (GRCm39) missense probably damaging 1.00
IGL01155:Ice1 APN 13 70,752,201 (GRCm39) missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70,753,023 (GRCm39) missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70,772,065 (GRCm39) missense probably damaging 1.00
IGL02423:Ice1 APN 13 70,740,718 (GRCm39) missense probably damaging 1.00
IGL02583:Ice1 APN 13 70,753,854 (GRCm39) missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70,757,278 (GRCm39) missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70,772,593 (GRCm39) splice site probably benign
IGL02929:Ice1 APN 13 70,744,322 (GRCm39) missense probably damaging 1.00
IGL03343:Ice1 APN 13 70,751,048 (GRCm39) missense probably damaging 1.00
IGL03384:Ice1 APN 13 70,751,368 (GRCm39) missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70,772,040 (GRCm39) critical splice donor site probably null
R0078:Ice1 UTSW 13 70,751,467 (GRCm39) missense probably damaging 0.98
R0081:Ice1 UTSW 13 70,767,163 (GRCm39) nonsense probably null
R0281:Ice1 UTSW 13 70,752,166 (GRCm39) missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70,749,310 (GRCm39) missense probably benign 0.08
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0973:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R0974:Ice1 UTSW 13 70,750,546 (GRCm39) missense probably benign 0.04
R1033:Ice1 UTSW 13 70,754,713 (GRCm39) missense probably damaging 0.96
R1371:Ice1 UTSW 13 70,744,340 (GRCm39) missense probably damaging 1.00
R1525:Ice1 UTSW 13 70,753,529 (GRCm39) missense probably benign 0.01
R1539:Ice1 UTSW 13 70,754,023 (GRCm39) missense probably damaging 1.00
R1596:Ice1 UTSW 13 70,753,014 (GRCm39) missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70,751,472 (GRCm39) missense probably benign 0.01
R1680:Ice1 UTSW 13 70,753,567 (GRCm39) missense probably benign 0.00
R1737:Ice1 UTSW 13 70,754,444 (GRCm39) missense probably damaging 0.99
R1766:Ice1 UTSW 13 70,752,561 (GRCm39) missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70,752,672 (GRCm39) missense probably damaging 1.00
R1834:Ice1 UTSW 13 70,763,457 (GRCm39) missense probably damaging 0.99
R1840:Ice1 UTSW 13 70,754,337 (GRCm39) missense probably benign 0.00
R1898:Ice1 UTSW 13 70,750,426 (GRCm39) missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70,753,202 (GRCm39) missense probably benign 0.18
R2000:Ice1 UTSW 13 70,750,546 (GRCm39) missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70,753,741 (GRCm39) missense probably benign 0.00
R2293:Ice1 UTSW 13 70,763,076 (GRCm39) missense probably damaging 1.00
R2377:Ice1 UTSW 13 70,750,899 (GRCm39) missense probably damaging 1.00
R2909:Ice1 UTSW 13 70,744,292 (GRCm39) missense probably damaging 1.00
R2965:Ice1 UTSW 13 70,750,697 (GRCm39) missense probably benign 0.31
R3730:Ice1 UTSW 13 70,751,359 (GRCm39) missense probably damaging 1.00
R3886:Ice1 UTSW 13 70,753,489 (GRCm39) missense probably benign 0.00
R3914:Ice1 UTSW 13 70,754,203 (GRCm39) missense probably benign 0.30
R4051:Ice1 UTSW 13 70,751,646 (GRCm39) missense probably damaging 1.00
R4321:Ice1 UTSW 13 70,751,229 (GRCm39) missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70,757,146 (GRCm39) missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70,754,503 (GRCm39) missense probably damaging 1.00
R5078:Ice1 UTSW 13 70,752,969 (GRCm39) missense probably benign
R5431:Ice1 UTSW 13 70,740,769 (GRCm39) missense probably damaging 1.00
R5722:Ice1 UTSW 13 70,763,219 (GRCm39) missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70,754,620 (GRCm39) missense probably benign 0.04
R6171:Ice1 UTSW 13 70,754,850 (GRCm39) missense probably benign
R6253:Ice1 UTSW 13 70,751,283 (GRCm39) missense probably damaging 1.00
R6274:Ice1 UTSW 13 70,742,958 (GRCm39) missense probably damaging 0.97
R6518:Ice1 UTSW 13 70,754,428 (GRCm39) missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70,751,592 (GRCm39) missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70,763,382 (GRCm39) splice site probably null
R6853:Ice1 UTSW 13 70,751,421 (GRCm39) missense possibly damaging 0.92
R6917:Ice1 UTSW 13 70,743,013 (GRCm39) missense probably damaging 1.00
R7032:Ice1 UTSW 13 70,744,283 (GRCm39) missense probably damaging 0.99
R7176:Ice1 UTSW 13 70,772,525 (GRCm39) critical splice donor site probably null
R7352:Ice1 UTSW 13 70,754,221 (GRCm39) nonsense probably null
R7445:Ice1 UTSW 13 70,744,286 (GRCm39) missense
R7646:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70,753,602 (GRCm39) missense probably damaging 1.00
R7650:Ice1 UTSW 13 70,737,916 (GRCm39) missense possibly damaging 0.93
R7812:Ice1 UTSW 13 70,751,124 (GRCm39) missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70,751,851 (GRCm39) missense probably damaging 1.00
R8129:Ice1 UTSW 13 70,754,320 (GRCm39) missense probably benign 0.02
R8283:Ice1 UTSW 13 70,752,549 (GRCm39) missense probably damaging 0.97
R8303:Ice1 UTSW 13 70,754,526 (GRCm39) missense probably benign 0.04
R8444:Ice1 UTSW 13 70,752,495 (GRCm39) missense probably damaging 1.00
R8474:Ice1 UTSW 13 70,752,566 (GRCm39) missense probably benign 0.42
R8751:Ice1 UTSW 13 70,751,010 (GRCm39) missense probably damaging 1.00
R8887:Ice1 UTSW 13 70,751,050 (GRCm39) missense probably damaging 1.00
R8911:Ice1 UTSW 13 70,740,787 (GRCm39) missense
R8954:Ice1 UTSW 13 70,758,697 (GRCm39) missense probably damaging 1.00
R9345:Ice1 UTSW 13 70,740,758 (GRCm39) missense
R9438:Ice1 UTSW 13 70,754,434 (GRCm39) missense probably benign 0.04
R9452:Ice1 UTSW 13 70,744,462 (GRCm39) missense probably damaging 1.00
X0026:Ice1 UTSW 13 70,740,721 (GRCm39) missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70,753,320 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATGCCTGACTGGGGAGTG -3'
(R):5'- TCATCTGAATTTGTGAGGGACAG -3'

Sequencing Primer
(F):5'- AGTGGACTCCCGCACATCTC -3'
(R):5'- TCTGAATTTGTGAGGGACAGAGGAG -3'
Posted On 2017-02-28