Incidental Mutation 'R5914:Kcnrg'
ID461227
Institutional Source Beutler Lab
Gene Symbol Kcnrg
Ensembl Gene ENSMUSG00000046168
Gene Namepotassium channel regulator
SynonymsE030012H22Rik, LOC328424
MMRRC Submission 044111-MU
Accession Numbers

Genbank: NM_001039105, NM_206974; MGI: 2685591

Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R5914 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location61607457-61612826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61611831 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 247 (M247T)
Ref Sequence ENSEMBL: ENSMUSP00000055327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051184] [ENSMUST00000225582]
Predicted Effect probably benign
Transcript: ENSMUST00000051184
AA Change: M247T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055327
Gene: ENSMUSG00000046168
AA Change: M247T

DomainStartEndE-ValueType
BTB 5 106 8.7e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183066
Predicted Effect probably benign
Transcript: ENSMUST00000225582
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which regulates the activity of voltage-gated potassium channels. This gene is on chromosome 13 and overlaps the gene for tripartite motif containing 13 on the same strand. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,538,370 R286H possibly damaging Het
Ank3 A T 10: 69,992,944 probably benign Het
Arhgap24 G A 5: 102,552,159 probably null Het
Arhgef2 T C 3: 88,635,869 Y396H probably benign Het
Asap3 G T 4: 136,241,409 G722C probably benign Het
Birc3 A C 9: 7,857,342 *377E probably null Het
Cdc123 G T 2: 5,798,363 Q282K possibly damaging Het
Cdkl4 C T 17: 80,547,691 probably null Het
Cep97 T C 16: 55,905,457 N689S probably benign Het
Cfap97 T G 8: 46,181,858 S407A probably damaging Het
Cfh A T 1: 140,136,229 N436K probably benign Het
Chpf2 A T 5: 24,592,423 probably benign Het
Cnnm2 A G 19: 46,763,177 T469A probably benign Het
Col6a3 T A 1: 90,776,200 I2275F unknown Het
Ctdspl2 A T 2: 121,978,933 N122Y probably damaging Het
Dcaf6 A T 1: 165,351,155 C602S probably benign Het
Dda1 T A 8: 71,474,650 probably benign Het
Dixdc1 T C 9: 50,698,588 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Emilin3 T A 2: 160,909,070 N253I probably damaging Het
Epg5 T A 18: 77,959,632 probably null Het
Fam204a A T 19: 60,221,093 Y68* probably null Het
Fbln5 T G 12: 101,760,743 D329A possibly damaging Het
Fkbp15 T A 4: 62,327,810 probably null Het
Fnbp4 C G 2: 90,774,793 probably benign Het
Foxn2 C A 17: 88,462,710 probably null Het
Frem1 T C 4: 83,001,775 D448G probably damaging Het
Fzd9 T C 5: 135,249,345 Y562C probably benign Het
Gcn1l1 A G 5: 115,610,135 silent Het
Gm6003 A G 7: 33,165,266 noncoding transcript Het
Gnl3 C A 14: 31,016,896 E65D possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk2 C T 6: 82,736,634 R461K probably benign Het
Ice1 A G 13: 70,606,377 F530S possibly damaging Het
Ing3 T A 6: 21,968,905 S129T probably benign Het
Ino80 G A 2: 119,458,216 S3L probably damaging Het
Ints2 T A 11: 86,222,174 Q839H probably benign Het
Kpna6 T C 4: 129,672,692 probably benign Het
Krtap28-13 T A 1: 83,061,323 probably benign Het
Lgr4 T A 2: 109,918,272 V51E possibly damaging Het
Map3k5 A C 10: 20,104,255 E836D probably benign Het
Mapk11 T C 15: 89,145,835 I193V probably benign Het
March10 A T 11: 105,385,482 V660E probably damaging Het
Matn4 T C 2: 164,393,224 E435G probably damaging Het
Mre11a G T 9: 14,811,936 R402M probably damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Ndufv3 C T 17: 31,531,232 R99* probably null Het
Nkx6-1 C T 5: 101,663,981 S85N unknown Het
Nop2 A T 6: 125,134,728 E141D probably benign Het
Olfr1469 A G 19: 13,410,962 H131R probably benign Het
Olfr906 G C 9: 38,488,361 E111Q probably damaging Het
Paox T C 7: 140,129,188 S205P probably damaging Het
Pcdh15 T C 10: 74,630,936 V995A probably benign Het
Pdcd1 T A 1: 94,040,825 K161N probably benign Het
Pfkfb2 C A 1: 130,700,095 V372L probably damaging Het
Phldb1 G A 9: 44,711,651 T19I probably damaging Het
Pik3c2g G T 6: 139,622,479 V198L probably benign Het
Pnpla8 T A 12: 44,295,970 L41* probably null Het
Postn C T 3: 54,373,800 Q449* probably null Het
Ppp1r3a C T 6: 14,718,989 S642N probably benign Het
Ptpn23 G A 9: 110,385,443 probably benign Het
Ptprj T C 2: 90,453,340 N923S possibly damaging Het
Rai1 T C 11: 60,187,804 V898A probably benign Het
Rasgef1a A T 6: 118,080,554 Y72F possibly damaging Het
Serpinb7 T C 1: 107,451,850 V329A probably damaging Het
Slc24a4 T A 12: 102,234,790 I311N probably damaging Het
Slc45a1 C A 4: 150,629,540 L749F possibly damaging Het
Spon1 G A 7: 114,030,821 D428N probably damaging Het
Tcf7l2 G A 19: 55,898,560 E2K probably benign Het
Thoc5 A G 11: 4,920,416 M472V possibly damaging Het
Tm6sf2 T C 8: 70,075,563 Y121H probably damaging Het
Tmc4 T A 7: 3,672,009 D221V probably benign Het
Trim30b A T 7: 104,357,365 S95T probably damaging Het
Trip12 T C 1: 84,763,458 E571G probably damaging Het
Ttn T C 2: 76,951,312 probably null Het
Ubp1 A T 9: 113,956,739 R161W probably benign Het
Usp21 G A 1: 171,282,171 probably benign Het
Vmn1r61 T A 7: 5,610,530 R262W probably damaging Het
Vmn2r67 A T 7: 85,151,836 D297E probably damaging Het
Vwa5a T C 9: 38,741,742 L784S probably benign Het
Vwc2 G A 11: 11,154,244 V259M probably damaging Het
Zeb2 T C 2: 44,997,052 I596M probably benign Het
Zgrf1 T A 3: 127,561,023 L97H probably damaging Het
Other mutations in Kcnrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kcnrg APN 14 61607910 missense probably damaging 1.00
IGL01311:Kcnrg APN 14 61611825 missense probably damaging 1.00
D4216:Kcnrg UTSW 14 61611793 nonsense probably null
R1081:Kcnrg UTSW 14 61607714 missense possibly damaging 0.87
R1346:Kcnrg UTSW 14 61611695 missense probably benign 0.31
R3147:Kcnrg UTSW 14 61607691 missense probably damaging 1.00
R4690:Kcnrg UTSW 14 61611727 missense probably damaging 1.00
R4820:Kcnrg UTSW 14 61607937 missense probably benign 0.39
R5068:Kcnrg UTSW 14 61607817 missense probably damaging 1.00
R7234:Kcnrg UTSW 14 61608082 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGGTACAATGCCTTTATTTGAGGG -3'
(R):5'- TCCAATGCTGATTTGAGAGAAGAG -3'

Sequencing Primer
(F):5'- CTCAGGTACATTTCCATAAAGCCTG -3'
(R):5'- CTGATTTGAGAGAAGAGGCAGTGTG -3'
Posted On2017-02-28