Incidental Mutation 'R5914:Cep97'
ID461231
Institutional Source Beutler Lab
Gene Symbol Cep97
Ensembl Gene ENSMUSG00000022604
Gene Namecentrosomal protein 97
Synonyms4932439K18Rik, E130116N02Rik, Lrriq2, 2810403B08Rik
MMRRC Submission 044111-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5914 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location55899888-55934855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55905457 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 689 (N689S)
Ref Sequence ENSEMBL: ENSMUSP00000112663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023270] [ENSMUST00000117468] [ENSMUST00000118500]
Predicted Effect probably benign
Transcript: ENSMUST00000023270
AA Change: N761S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000023270
Gene: ENSMUSG00000022604
AA Change: N761S

DomainStartEndE-ValueType
Pfam:LRR_9 98 259 1.8e-12 PFAM
IQ 549 571 2e-1 SMART
coiled coil region 576 609 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 775 789 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117468
AA Change: N689S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112687
Gene: ENSMUSG00000022604
AA Change: N689S

DomainStartEndE-ValueType
Pfam:LRR_9 7 187 4.1e-12 PFAM
Pfam:LRR_8 30 86 1e-7 PFAM
Pfam:LRR_4 52 94 3.6e-8 PFAM
Pfam:LRR_1 53 73 1.3e-2 PFAM
IQ 477 499 2e-1 SMART
coiled coil region 504 537 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 703 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118500
AA Change: N689S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000112663
Gene: ENSMUSG00000022604
AA Change: N689S

DomainStartEndE-ValueType
Pfam:LRR_9 7 187 4.1e-12 PFAM
Pfam:LRR_8 30 86 1e-7 PFAM
Pfam:LRR_4 52 94 3.6e-8 PFAM
Pfam:LRR_1 53 73 1.3e-2 PFAM
IQ 477 499 2e-1 SMART
coiled coil region 504 537 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 703 717 N/A INTRINSIC
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 95% (87/92)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,538,370 R286H possibly damaging Het
Ank3 A T 10: 69,992,944 probably benign Het
Arhgap24 G A 5: 102,552,159 probably null Het
Arhgef2 T C 3: 88,635,869 Y396H probably benign Het
Asap3 G T 4: 136,241,409 G722C probably benign Het
Birc3 A C 9: 7,857,342 *377E probably null Het
Cdc123 G T 2: 5,798,363 Q282K possibly damaging Het
Cdkl4 C T 17: 80,547,691 probably null Het
Cfap97 T G 8: 46,181,858 S407A probably damaging Het
Cfh A T 1: 140,136,229 N436K probably benign Het
Chpf2 A T 5: 24,592,423 probably benign Het
Cnnm2 A G 19: 46,763,177 T469A probably benign Het
Col6a3 T A 1: 90,776,200 I2275F unknown Het
Ctdspl2 A T 2: 121,978,933 N122Y probably damaging Het
Dcaf6 A T 1: 165,351,155 C602S probably benign Het
Dda1 T A 8: 71,474,650 probably benign Het
Dixdc1 T C 9: 50,698,588 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Emilin3 T A 2: 160,909,070 N253I probably damaging Het
Epg5 T A 18: 77,959,632 probably null Het
Fam204a A T 19: 60,221,093 Y68* probably null Het
Fbln5 T G 12: 101,760,743 D329A possibly damaging Het
Fkbp15 T A 4: 62,327,810 probably null Het
Fnbp4 C G 2: 90,774,793 probably benign Het
Foxn2 C A 17: 88,462,710 probably null Het
Frem1 T C 4: 83,001,775 D448G probably damaging Het
Fzd9 T C 5: 135,249,345 Y562C probably benign Het
Gcn1l1 A G 5: 115,610,135 silent Het
Gm6003 A G 7: 33,165,266 noncoding transcript Het
Gnl3 C A 14: 31,016,896 E65D possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk2 C T 6: 82,736,634 R461K probably benign Het
Ice1 A G 13: 70,606,377 F530S possibly damaging Het
Ing3 T A 6: 21,968,905 S129T probably benign Het
Ino80 G A 2: 119,458,216 S3L probably damaging Het
Ints2 T A 11: 86,222,174 Q839H probably benign Het
Kcnrg T C 14: 61,611,831 M247T probably benign Het
Kpna6 T C 4: 129,672,692 probably benign Het
Krtap28-13 T A 1: 83,061,323 probably benign Het
Lgr4 T A 2: 109,918,272 V51E possibly damaging Het
Map3k5 A C 10: 20,104,255 E836D probably benign Het
Mapk11 T C 15: 89,145,835 I193V probably benign Het
March10 A T 11: 105,385,482 V660E probably damaging Het
Matn4 T C 2: 164,393,224 E435G probably damaging Het
Mre11a G T 9: 14,811,936 R402M probably damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Ndufv3 C T 17: 31,531,232 R99* probably null Het
Nkx6-1 C T 5: 101,663,981 S85N unknown Het
Nop2 A T 6: 125,134,728 E141D probably benign Het
Olfr1469 A G 19: 13,410,962 H131R probably benign Het
Olfr906 G C 9: 38,488,361 E111Q probably damaging Het
Paox T C 7: 140,129,188 S205P probably damaging Het
Pcdh15 T C 10: 74,630,936 V995A probably benign Het
Pdcd1 T A 1: 94,040,825 K161N probably benign Het
Pfkfb2 C A 1: 130,700,095 V372L probably damaging Het
Phldb1 G A 9: 44,711,651 T19I probably damaging Het
Pik3c2g G T 6: 139,622,479 V198L probably benign Het
Pnpla8 T A 12: 44,295,970 L41* probably null Het
Postn C T 3: 54,373,800 Q449* probably null Het
Ppp1r3a C T 6: 14,718,989 S642N probably benign Het
Ptpn23 G A 9: 110,385,443 probably benign Het
Ptprj T C 2: 90,453,340 N923S possibly damaging Het
Rai1 T C 11: 60,187,804 V898A probably benign Het
Rasgef1a A T 6: 118,080,554 Y72F possibly damaging Het
Serpinb7 T C 1: 107,451,850 V329A probably damaging Het
Slc24a4 T A 12: 102,234,790 I311N probably damaging Het
Slc45a1 C A 4: 150,629,540 L749F possibly damaging Het
Spon1 G A 7: 114,030,821 D428N probably damaging Het
Tcf7l2 G A 19: 55,898,560 E2K probably benign Het
Thoc5 A G 11: 4,920,416 M472V possibly damaging Het
Tm6sf2 T C 8: 70,075,563 Y121H probably damaging Het
Tmc4 T A 7: 3,672,009 D221V probably benign Het
Trim30b A T 7: 104,357,365 S95T probably damaging Het
Trip12 T C 1: 84,763,458 E571G probably damaging Het
Ttn T C 2: 76,951,312 probably null Het
Ubp1 A T 9: 113,956,739 R161W probably benign Het
Usp21 G A 1: 171,282,171 probably benign Het
Vmn1r61 T A 7: 5,610,530 R262W probably damaging Het
Vmn2r67 A T 7: 85,151,836 D297E probably damaging Het
Vwa5a T C 9: 38,741,742 L784S probably benign Het
Vwc2 G A 11: 11,154,244 V259M probably damaging Het
Zeb2 T C 2: 44,997,052 I596M probably benign Het
Zgrf1 T A 3: 127,561,023 L97H probably damaging Het
Other mutations in Cep97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Cep97 APN 16 55924960 splice site probably benign
IGL01142:Cep97 APN 16 55922198 missense probably damaging 1.00
IGL01383:Cep97 APN 16 55911607 missense probably damaging 1.00
IGL01529:Cep97 APN 16 55930618 splice site probably benign
IGL01693:Cep97 APN 16 55930594 missense probably damaging 1.00
IGL01759:Cep97 APN 16 55930573 missense probably damaging 1.00
IGL02085:Cep97 APN 16 55915505 missense probably damaging 1.00
IGL02135:Cep97 APN 16 55922967 missense probably damaging 1.00
IGL02582:Cep97 APN 16 55922176 missense probably damaging 1.00
IGL02631:Cep97 APN 16 55922178 nonsense probably null
IGL02899:Cep97 APN 16 55918540 missense probably damaging 0.98
IGL03086:Cep97 APN 16 55915296 missense probably benign
R0067:Cep97 UTSW 16 55915561 missense possibly damaging 0.96
R0067:Cep97 UTSW 16 55915561 missense possibly damaging 0.96
R0309:Cep97 UTSW 16 55925058 missense probably damaging 0.96
R0504:Cep97 UTSW 16 55905779 missense probably benign 0.00
R0507:Cep97 UTSW 16 55905882 splice site probably benign
R0508:Cep97 UTSW 16 55930606 missense probably benign 0.02
R0658:Cep97 UTSW 16 55914902 missense probably benign 0.09
R1588:Cep97 UTSW 16 55927821 missense probably damaging 1.00
R1619:Cep97 UTSW 16 55927796 missense probably damaging 1.00
R1710:Cep97 UTSW 16 55915022 missense probably damaging 0.99
R1872:Cep97 UTSW 16 55927866 missense probably damaging 1.00
R1878:Cep97 UTSW 16 55905226 missense probably damaging 1.00
R1896:Cep97 UTSW 16 55927744 missense probably damaging 1.00
R5401:Cep97 UTSW 16 55924952 missense probably benign 0.03
R5520:Cep97 UTSW 16 55915296 missense probably benign
R5627:Cep97 UTSW 16 55924967 critical splice donor site probably null
R5632:Cep97 UTSW 16 55915583 missense probably benign 0.02
R5903:Cep97 UTSW 16 55919526 missense probably damaging 1.00
R6185:Cep97 UTSW 16 55915092 missense probably benign
R6381:Cep97 UTSW 16 55922171 missense probably damaging 1.00
R7041:Cep97 UTSW 16 55905754 missense probably benign
R7056:Cep97 UTSW 16 55905572 missense probably damaging 1.00
R7371:Cep97 UTSW 16 55905320 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGCTTCTTCGTTTAACTGAC -3'
(R):5'- AGAGCAAGTTCCCTGTCTGC -3'

Sequencing Primer
(F):5'- TAACTGACAATTCTCTGGCGTCTGG -3'
(R):5'- CAGGATTCGTTGGATTTTGAAAAGAG -3'
Posted On2017-02-28