Incidental Mutation 'R5914:Epg5'
ID461235
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Nameectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms
MMRRC Submission 044111-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R5914 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location77938467-78035027 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 77959632 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
Predicted Effect probably null
Transcript: ENSMUST00000044622
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Meta Mutation Damage Score 0.9505 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 95% (87/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 G A 15: 74,538,370 R286H possibly damaging Het
Ank3 A T 10: 69,992,944 probably benign Het
Arhgap24 G A 5: 102,552,159 probably null Het
Arhgef2 T C 3: 88,635,869 Y396H probably benign Het
Asap3 G T 4: 136,241,409 G722C probably benign Het
Birc3 A C 9: 7,857,342 *377E probably null Het
Cdc123 G T 2: 5,798,363 Q282K possibly damaging Het
Cdkl4 C T 17: 80,547,691 probably null Het
Cep97 T C 16: 55,905,457 N689S probably benign Het
Cfap97 T G 8: 46,181,858 S407A probably damaging Het
Cfh A T 1: 140,136,229 N436K probably benign Het
Chpf2 A T 5: 24,592,423 probably benign Het
Cnnm2 A G 19: 46,763,177 T469A probably benign Het
Col6a3 T A 1: 90,776,200 I2275F unknown Het
Ctdspl2 A T 2: 121,978,933 N122Y probably damaging Het
Dcaf6 A T 1: 165,351,155 C602S probably benign Het
Dda1 T A 8: 71,474,650 probably benign Het
Dixdc1 T C 9: 50,698,588 probably benign Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Emilin3 T A 2: 160,909,070 N253I probably damaging Het
Fam204a A T 19: 60,221,093 Y68* probably null Het
Fbln5 T G 12: 101,760,743 D329A possibly damaging Het
Fkbp15 T A 4: 62,327,810 probably null Het
Fnbp4 C G 2: 90,774,793 probably benign Het
Foxn2 C A 17: 88,462,710 probably null Het
Frem1 T C 4: 83,001,775 D448G probably damaging Het
Fzd9 T C 5: 135,249,345 Y562C probably benign Het
Gcn1l1 A G 5: 115,610,135 silent Het
Gm6003 A G 7: 33,165,266 noncoding transcript Het
Gnl3 C A 14: 31,016,896 E65D possibly damaging Het
Hax1 GTCATCATCATCATCATC GTCATCATCATCATCATCATC 3: 89,997,940 probably benign Het
Hk2 C T 6: 82,736,634 R461K probably benign Het
Ice1 A G 13: 70,606,377 F530S possibly damaging Het
Ing3 T A 6: 21,968,905 S129T probably benign Het
Ino80 G A 2: 119,458,216 S3L probably damaging Het
Ints2 T A 11: 86,222,174 Q839H probably benign Het
Kcnrg T C 14: 61,611,831 M247T probably benign Het
Kpna6 T C 4: 129,672,692 probably benign Het
Krtap28-13 T A 1: 83,061,323 probably benign Het
Lgr4 T A 2: 109,918,272 V51E possibly damaging Het
Map3k5 A C 10: 20,104,255 E836D probably benign Het
Mapk11 T C 15: 89,145,835 I193V probably benign Het
March10 A T 11: 105,385,482 V660E probably damaging Het
Matn4 T C 2: 164,393,224 E435G probably damaging Het
Mre11a G T 9: 14,811,936 R402M probably damaging Het
Msr1 C T 8: 39,581,827 G428R probably damaging Het
Ndufv3 C T 17: 31,531,232 R99* probably null Het
Nkx6-1 C T 5: 101,663,981 S85N unknown Het
Nop2 A T 6: 125,134,728 E141D probably benign Het
Olfr1469 A G 19: 13,410,962 H131R probably benign Het
Olfr906 G C 9: 38,488,361 E111Q probably damaging Het
Paox T C 7: 140,129,188 S205P probably damaging Het
Pcdh15 T C 10: 74,630,936 V995A probably benign Het
Pdcd1 T A 1: 94,040,825 K161N probably benign Het
Pfkfb2 C A 1: 130,700,095 V372L probably damaging Het
Phldb1 G A 9: 44,711,651 T19I probably damaging Het
Pik3c2g G T 6: 139,622,479 V198L probably benign Het
Pnpla8 T A 12: 44,295,970 L41* probably null Het
Postn C T 3: 54,373,800 Q449* probably null Het
Ppp1r3a C T 6: 14,718,989 S642N probably benign Het
Ptpn23 G A 9: 110,385,443 probably benign Het
Ptprj T C 2: 90,453,340 N923S possibly damaging Het
Rai1 T C 11: 60,187,804 V898A probably benign Het
Rasgef1a A T 6: 118,080,554 Y72F possibly damaging Het
Serpinb7 T C 1: 107,451,850 V329A probably damaging Het
Slc24a4 T A 12: 102,234,790 I311N probably damaging Het
Slc45a1 C A 4: 150,629,540 L749F possibly damaging Het
Spon1 G A 7: 114,030,821 D428N probably damaging Het
Tcf7l2 G A 19: 55,898,560 E2K probably benign Het
Thoc5 A G 11: 4,920,416 M472V possibly damaging Het
Tm6sf2 T C 8: 70,075,563 Y121H probably damaging Het
Tmc4 T A 7: 3,672,009 D221V probably benign Het
Trim30b A T 7: 104,357,365 S95T probably damaging Het
Trip12 T C 1: 84,763,458 E571G probably damaging Het
Ttn T C 2: 76,951,312 probably null Het
Ubp1 A T 9: 113,956,739 R161W probably benign Het
Usp21 G A 1: 171,282,171 probably benign Het
Vmn1r61 T A 7: 5,610,530 R262W probably damaging Het
Vmn2r67 A T 7: 85,151,836 D297E probably damaging Het
Vwa5a T C 9: 38,741,742 L784S probably benign Het
Vwc2 G A 11: 11,154,244 V259M probably damaging Het
Zeb2 T C 2: 44,997,052 I596M probably benign Het
Zgrf1 T A 3: 127,561,023 L97H probably damaging Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78012741 missense probably damaging 1.00
IGL01778:Epg5 APN 18 78019274 missense probably damaging 0.98
IGL01936:Epg5 APN 18 77985101 missense probably damaging 1.00
IGL02189:Epg5 APN 18 78012870 missense probably damaging 0.99
IGL02323:Epg5 APN 18 78012832 nonsense probably null
IGL02567:Epg5 APN 18 78033073 missense probably damaging 1.00
IGL02805:Epg5 APN 18 78030191 splice site probably benign
IGL03282:Epg5 APN 18 77986426 missense probably benign 0.25
stitch UTSW 18 77948299 nonsense probably null
R0011:Epg5 UTSW 18 77948483 missense probably benign
R0172:Epg5 UTSW 18 78027359 missense probably benign 0.00
R0335:Epg5 UTSW 18 77986472 missense probably benign 0.25
R0380:Epg5 UTSW 18 77960841 missense probably damaging 1.00
R0441:Epg5 UTSW 18 78023271 splice site probably benign
R0443:Epg5 UTSW 18 77955903 splice site probably benign
R0445:Epg5 UTSW 18 78014184 missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78023365 missense probably damaging 1.00
R0892:Epg5 UTSW 18 77968628 missense possibly damaging 0.94
R1081:Epg5 UTSW 18 77959533 missense possibly damaging 0.92
R1183:Epg5 UTSW 18 77960711 missense probably damaging 1.00
R1374:Epg5 UTSW 18 77981326 missense probably benign
R1428:Epg5 UTSW 18 77962427 missense probably damaging 1.00
R1727:Epg5 UTSW 18 78015815 missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78023990 missense probably damaging 0.99
R1801:Epg5 UTSW 18 77983490 missense possibly damaging 0.63
R1864:Epg5 UTSW 18 77975031 missense probably damaging 0.99
R1908:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1909:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1916:Epg5 UTSW 18 77965021 missense probably benign 0.00
R1986:Epg5 UTSW 18 77982306 critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78023987 missense probably damaging 0.98
R2080:Epg5 UTSW 18 77948745 missense probably benign 0.01
R2106:Epg5 UTSW 18 77991363 nonsense probably null
R2144:Epg5 UTSW 18 77954197 missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78027302 missense probably benign
R2217:Epg5 UTSW 18 77949072 missense probably benign
R2424:Epg5 UTSW 18 77968613 missense probably benign 0.05
R2909:Epg5 UTSW 18 77983476 missense probably damaging 1.00
R3725:Epg5 UTSW 18 78017679 missense probably benign 0.00
R3899:Epg5 UTSW 18 77957510 missense probably damaging 1.00
R4019:Epg5 UTSW 18 78030450 missense probably damaging 0.98
R4260:Epg5 UTSW 18 77959121 missense possibly damaging 0.50
R4260:Epg5 UTSW 18 78015699 missense probably damaging 1.00
R4448:Epg5 UTSW 18 77962461 missense probably damaging 1.00
R4475:Epg5 UTSW 18 77948508 missense probably benign
R4612:Epg5 UTSW 18 77982414 missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78012864 missense probably benign 0.45
R4767:Epg5 UTSW 18 78023283 missense possibly damaging 0.67
R4779:Epg5 UTSW 18 77991365 missense probably benign 0.01
R4791:Epg5 UTSW 18 77948996 nonsense probably null
R4797:Epg5 UTSW 18 78030399 missense probably benign 0.00
R4812:Epg5 UTSW 18 77979184 missense probably benign 0.01
R4899:Epg5 UTSW 18 77985057 missense probably damaging 1.00
R5000:Epg5 UTSW 18 77954161 missense probably benign
R5031:Epg5 UTSW 18 78028948 missense probably benign 0.00
R5050:Epg5 UTSW 18 77975941 missense possibly damaging 0.55
R5114:Epg5 UTSW 18 77995613 missense probably benign
R5144:Epg5 UTSW 18 78015680 missense probably damaging 1.00
R5209:Epg5 UTSW 18 77951282 missense probably damaging 1.00
R5213:Epg5 UTSW 18 78014834 missense probably benign 0.01
R5270:Epg5 UTSW 18 77983563 missense possibly damaging 0.79
R5324:Epg5 UTSW 18 77962445 missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78027497 missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77951207 missense possibly damaging 0.81
R5593:Epg5 UTSW 18 77957474 missense probably damaging 1.00
R5718:Epg5 UTSW 18 77986403 missense probably damaging 1.00
R5773:Epg5 UTSW 18 77960825 missense probably damaging 1.00
R5828:Epg5 UTSW 18 78020851 missense probably damaging 0.99
R5847:Epg5 UTSW 18 78030055 missense probably benign 0.06
R5858:Epg5 UTSW 18 77948299 nonsense probably null
R6124:Epg5 UTSW 18 78030045 missense probably benign
R6228:Epg5 UTSW 18 77948462 missense possibly damaging 0.90
R6252:Epg5 UTSW 18 77985167 missense probably damaging 1.00
R6269:Epg5 UTSW 18 77948370 missense probably benign
R6312:Epg5 UTSW 18 77979211 missense possibly damaging 0.72
R6320:Epg5 UTSW 18 77962398 missense probably damaging 1.00
R6328:Epg5 UTSW 18 78028964 missense possibly damaging 0.88
R6430:Epg5 UTSW 18 77975885 missense probably damaging 1.00
R6458:Epg5 UTSW 18 77948254 missense probably benign 0.03
R6852:Epg5 UTSW 18 78012891 missense probably damaging 1.00
R6915:Epg5 UTSW 18 77979165 missense probably benign 0.00
R6930:Epg5 UTSW 18 78014163 missense probably damaging 0.99
R6932:Epg5 UTSW 18 77948609 missense probably benign 0.00
R7127:Epg5 UTSW 18 78028925 missense probably damaging 1.00
R7207:Epg5 UTSW 18 77948955 missense probably damaging 1.00
R7225:Epg5 UTSW 18 78012702 missense probably benign 0.45
R7358:Epg5 UTSW 18 77959037 missense possibly damaging 0.78
R7414:Epg5 UTSW 18 77983532 missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78023278 missense probably benign 0.01
R7535:Epg5 UTSW 18 78032926 missense probably benign 0.18
R7586:Epg5 UTSW 18 78030060 missense probably benign
R7651:Epg5 UTSW 18 77981400 nonsense probably null
R7715:Epg5 UTSW 18 77968586 missense probably damaging 1.00
R7753:Epg5 UTSW 18 77948345 missense possibly damaging 0.92
X0023:Epg5 UTSW 18 77968657 missense probably damaging 0.99
X0060:Epg5 UTSW 18 77962485 missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 77959139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAATCGTACGTCTGTGTTCTGC -3'
(R):5'- TGGGATGCTTAACCACATACTCTC -3'

Sequencing Primer
(F):5'- TGCAGTGTTTTTGTCTACTAACTAC -3'
(R):5'- GATGCTTAACCACATACTCTCACTGG -3'
Posted On2017-02-28