Mutagenetix > Incidental Mutation

Incidental Mutation 'R5914:Epg5'

461235

Institutional Source

Beutler Lab

Gene Symbol

Epg5

Ensembl Gene

ENSMUSG00000039840

Gene Name

ectopic P-granules autophagy protein 5 homolog (C. elegans)

Synonyms

MMRRC Submission

044111-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.942) question?

Stock #

R5914 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77938467-78035027 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 77959632 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000038681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044622]

AlphaFold

Q80TA9

Predicted Effect

probably null
Transcript: ENSMUST00000044622

SMART Domains

Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840

Domain	Start	End	E-Value	Type
low complexity region	299	309	N/A	INTRINSIC
low complexity region	395	406	N/A	INTRINSIC
low complexity region	1074	1085	N/A	INTRINSIC
low complexity region	1499	1516	N/A	INTRINSIC
coiled coil region	1600	1626	N/A	INTRINSIC
low complexity region	2132	2145	N/A	INTRINSIC
low complexity region	2416	2427	N/A	INTRINSIC
low complexity region	2454	2469	N/A	INTRINSIC

Meta Mutation Damage Score

0.9505

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.5%

Validation Efficiency

95% (87/92)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	G	A	15: 74,538,370	R286H	possibly damaging	Het
Ank3	A	T	10: 69,992,944		probably benign	Het
Arhgap24	G	A	5: 102,552,159		probably null	Het
Arhgef2	T	C	3: 88,635,869	Y396H	probably benign	Het
Asap3	G	T	4: 136,241,409	G722C	probably benign	Het
Birc3	A	C	9: 7,857,342	*377E	probably null	Het
Cdc123	G	T	2: 5,798,363	Q282K	possibly damaging	Het
Cdkl4	C	T	17: 80,547,691		probably null	Het
Cep97	T	C	16: 55,905,457	N689S	probably benign	Het
Cfap97	T	G	8: 46,181,858	S407A	probably damaging	Het
Cfh	A	T	1: 140,136,229	N436K	probably benign	Het
Chpf2	A	T	5: 24,592,423		probably benign	Het
Cnnm2	A	G	19: 46,763,177	T469A	probably benign	Het
Col6a3	T	A	1: 90,776,200	I2275F	unknown	Het
Ctdspl2	A	T	2: 121,978,933	N122Y	probably damaging	Het
Dcaf6	A	T	1: 165,351,155	C602S	probably benign	Het
Dda1	T	A	8: 71,474,650		probably benign	Het
Dixdc1	T	C	9: 50,698,588		probably benign	Het
Dnah2	C	T	11: 69,458,920	R2399Q	probably benign	Het
Emilin3	T	A	2: 160,909,070	N253I	probably damaging	Het
Fam204a	A	T	19: 60,221,093	Y68*	probably null	Het
Fbln5	T	G	12: 101,760,743	D329A	possibly damaging	Het
Fkbp15	T	A	4: 62,327,810		probably null	Het
Fnbp4	C	G	2: 90,774,793		probably benign	Het
Foxn2	C	A	17: 88,462,710		probably null	Het
Frem1	T	C	4: 83,001,775	D448G	probably damaging	Het
Fzd9	T	C	5: 135,249,345	Y562C	probably benign	Het
Gcn1l1	A	G	5: 115,610,135		silent	Het
Gm6003	A	G	7: 33,165,266		noncoding transcript	Het
Gnl3	C	A	14: 31,016,896	E65D	possibly damaging	Het
Hax1	GTCATCATCATCATCATC	GTCATCATCATCATCATCATC	3: 89,997,940		probably benign	Het
Hk2	C	T	6: 82,736,634	R461K	probably benign	Het
Ice1	A	G	13: 70,606,377	F530S	possibly damaging	Het
Ing3	T	A	6: 21,968,905	S129T	probably benign	Het
Ino80	G	A	2: 119,458,216	S3L	probably damaging	Het
Ints2	T	A	11: 86,222,174	Q839H	probably benign	Het
Kcnrg	T	C	14: 61,611,831	M247T	probably benign	Het
Kpna6	T	C	4: 129,672,692		probably benign	Het
Krtap28-13	T	A	1: 83,061,323		probably benign	Het
Lgr4	T	A	2: 109,918,272	V51E	possibly damaging	Het
Map3k5	A	C	10: 20,104,255	E836D	probably benign	Het
Mapk11	T	C	15: 89,145,835	I193V	probably benign	Het
March10	A	T	11: 105,385,482	V660E	probably damaging	Het
Matn4	T	C	2: 164,393,224	E435G	probably damaging	Het
Mre11a	G	T	9: 14,811,936	R402M	probably damaging	Het
Msr1	C	T	8: 39,581,827	G428R	probably damaging	Het
Ndufv3	C	T	17: 31,531,232	R99*	probably null	Het
Nkx6-1	C	T	5: 101,663,981	S85N	unknown	Het
Nop2	A	T	6: 125,134,728	E141D	probably benign	Het
Olfr1469	A	G	19: 13,410,962	H131R	probably benign	Het
Olfr906	G	C	9: 38,488,361	E111Q	probably damaging	Het
Paox	T	C	7: 140,129,188	S205P	probably damaging	Het
Pcdh15	T	C	10: 74,630,936	V995A	probably benign	Het
Pdcd1	T	A	1: 94,040,825	K161N	probably benign	Het
Pfkfb2	C	A	1: 130,700,095	V372L	probably damaging	Het
Phldb1	G	A	9: 44,711,651	T19I	probably damaging	Het
Pik3c2g	G	T	6: 139,622,479	V198L	probably benign	Het
Pnpla8	T	A	12: 44,295,970	L41*	probably null	Het
Postn	C	T	3: 54,373,800	Q449*	probably null	Het
Ppp1r3a	C	T	6: 14,718,989	S642N	probably benign	Het
Ptpn23	G	A	9: 110,385,443		probably benign	Het
Ptprj	T	C	2: 90,453,340	N923S	possibly damaging	Het
Rai1	T	C	11: 60,187,804	V898A	probably benign	Het
Rasgef1a	A	T	6: 118,080,554	Y72F	possibly damaging	Het
Serpinb7	T	C	1: 107,451,850	V329A	probably damaging	Het
Slc24a4	T	A	12: 102,234,790	I311N	probably damaging	Het
Slc45a1	C	A	4: 150,629,540	L749F	possibly damaging	Het
Spon1	G	A	7: 114,030,821	D428N	probably damaging	Het
Tcf7l2	G	A	19: 55,898,560	E2K	probably benign	Het
Thoc5	A	G	11: 4,920,416	M472V	possibly damaging	Het
Tm6sf2	T	C	8: 70,075,563	Y121H	probably damaging	Het
Tmc4	T	A	7: 3,672,009	D221V	probably benign	Het
Trim30b	A	T	7: 104,357,365	S95T	probably damaging	Het
Trip12	T	C	1: 84,763,458	E571G	probably damaging	Het
Ttn	T	C	2: 76,951,312		probably null	Het
Ubp1	A	T	9: 113,956,739	R161W	probably benign	Het
Usp21	G	A	1: 171,282,171		probably benign	Het
Vmn1r61	T	A	7: 5,610,530	R262W	probably damaging	Het
Vmn2r67	A	T	7: 85,151,836	D297E	probably damaging	Het
Vwa5a	T	C	9: 38,741,742	L784S	probably benign	Het
Vwc2	G	A	11: 11,154,244	V259M	probably damaging	Het
Zeb2	T	C	2: 44,997,052	I596M	probably benign	Het
Zgrf1	T	A	3: 127,561,023	L97H	probably damaging	Het

Other mutations in Epg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Epg5	APN	18	78012741	missense	probably damaging	1.00
IGL01778:Epg5	APN	18	78019274	missense	probably damaging	0.98
IGL01936:Epg5	APN	18	77985101	missense	probably damaging	1.00
IGL02189:Epg5	APN	18	78012870	missense	probably damaging	0.99
IGL02323:Epg5	APN	18	78012832	nonsense	probably null
IGL02567:Epg5	APN	18	78033073	missense	probably damaging	1.00
IGL02805:Epg5	APN	18	78030191	splice site	probably benign
IGL03282:Epg5	APN	18	77986426	missense	probably benign	0.25
stitch	UTSW	18	77948299	nonsense	probably null
R0011:Epg5	UTSW	18	77948483	missense	probably benign
R0172:Epg5	UTSW	18	78027359	missense	probably benign	0.00
R0335:Epg5	UTSW	18	77986472	missense	probably benign	0.25
R0380:Epg5	UTSW	18	77960841	missense	probably damaging	1.00
R0441:Epg5	UTSW	18	78023271	splice site	probably benign
R0443:Epg5	UTSW	18	77955903	splice site	probably benign
R0445:Epg5	UTSW	18	78014184	missense	possibly damaging	0.87
R0448:Epg5	UTSW	18	78023365	missense	probably damaging	1.00
R0892:Epg5	UTSW	18	77968628	missense	possibly damaging	0.94
R1081:Epg5	UTSW	18	77959533	missense	possibly damaging	0.92
R1183:Epg5	UTSW	18	77960711	missense	probably damaging	1.00
R1374:Epg5	UTSW	18	77981326	missense	probably benign
R1428:Epg5	UTSW	18	77962427	missense	probably damaging	1.00
R1727:Epg5	UTSW	18	78015815	missense	possibly damaging	0.94
R1780:Epg5	UTSW	18	78023990	missense	probably damaging	0.99
R1801:Epg5	UTSW	18	77983490	missense	possibly damaging	0.63
R1864:Epg5	UTSW	18	77975031	missense	probably damaging	0.99
R1908:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1909:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1916:Epg5	UTSW	18	77965021	missense	probably benign	0.00
R1986:Epg5	UTSW	18	77982306	critical splice acceptor site	probably null
R2048:Epg5	UTSW	18	78023987	missense	probably damaging	0.98
R2080:Epg5	UTSW	18	77948745	missense	probably benign	0.01
R2106:Epg5	UTSW	18	77991363	nonsense	probably null
R2144:Epg5	UTSW	18	77954197	missense	possibly damaging	0.78
R2151:Epg5	UTSW	18	78027302	missense	probably benign
R2217:Epg5	UTSW	18	77949072	missense	probably benign
R2424:Epg5	UTSW	18	77968613	missense	probably benign	0.05
R2909:Epg5	UTSW	18	77983476	missense	probably damaging	1.00
R3725:Epg5	UTSW	18	78017679	missense	probably benign	0.00
R3899:Epg5	UTSW	18	77957510	missense	probably damaging	1.00
R4019:Epg5	UTSW	18	78030450	missense	probably damaging	0.98
R4260:Epg5	UTSW	18	77959121	missense	possibly damaging	0.50
R4260:Epg5	UTSW	18	78015699	missense	probably damaging	1.00
R4448:Epg5	UTSW	18	77962461	missense	probably damaging	1.00
R4475:Epg5	UTSW	18	77948508	missense	probably benign
R4612:Epg5	UTSW	18	77982414	missense	possibly damaging	0.77
R4666:Epg5	UTSW	18	78012864	missense	probably benign	0.45
R4767:Epg5	UTSW	18	78023283	missense	possibly damaging	0.67
R4779:Epg5	UTSW	18	77991365	missense	probably benign	0.01
R4791:Epg5	UTSW	18	77948996	nonsense	probably null
R4797:Epg5	UTSW	18	78030399	missense	probably benign	0.00
R4812:Epg5	UTSW	18	77979184	missense	probably benign	0.01
R4899:Epg5	UTSW	18	77985057	missense	probably damaging	1.00
R5000:Epg5	UTSW	18	77954161	missense	probably benign
R5031:Epg5	UTSW	18	78028948	missense	probably benign	0.00
R5050:Epg5	UTSW	18	77975941	missense	possibly damaging	0.55
R5114:Epg5	UTSW	18	77995613	missense	probably benign
R5144:Epg5	UTSW	18	78015680	missense	probably damaging	1.00
R5209:Epg5	UTSW	18	77951282	missense	probably damaging	1.00
R5213:Epg5	UTSW	18	78014834	missense	probably benign	0.01
R5270:Epg5	UTSW	18	77983563	missense	possibly damaging	0.79
R5324:Epg5	UTSW	18	77962445	missense	possibly damaging	0.94
R5443:Epg5	UTSW	18	78027497	missense	possibly damaging	0.55
R5503:Epg5	UTSW	18	77951207	missense	possibly damaging	0.81
R5593:Epg5	UTSW	18	77957474	missense	probably damaging	1.00
R5718:Epg5	UTSW	18	77986403	missense	probably damaging	1.00
R5773:Epg5	UTSW	18	77960825	missense	probably damaging	1.00
R5828:Epg5	UTSW	18	78020851	missense	probably damaging	0.99
R5847:Epg5	UTSW	18	78030055	missense	probably benign	0.06
R5858:Epg5	UTSW	18	77948299	nonsense	probably null
R6124:Epg5	UTSW	18	78030045	missense	probably benign
R6228:Epg5	UTSW	18	77948462	missense	possibly damaging	0.90
R6252:Epg5	UTSW	18	77985167	missense	probably damaging	1.00
R6269:Epg5	UTSW	18	77948370	missense	probably benign
R6312:Epg5	UTSW	18	77979211	missense	possibly damaging	0.72
R6320:Epg5	UTSW	18	77962398	missense	probably damaging	1.00
R6328:Epg5	UTSW	18	78028964	missense	possibly damaging	0.88
R6430:Epg5	UTSW	18	77975885	missense	probably damaging	1.00
R6458:Epg5	UTSW	18	77948254	missense	probably benign	0.03
R6852:Epg5	UTSW	18	78012891	missense	probably damaging	1.00
R6915:Epg5	UTSW	18	77979165	missense	probably benign	0.00
R6930:Epg5	UTSW	18	78014163	missense	probably damaging	0.99
R6932:Epg5	UTSW	18	77948609	missense	probably benign	0.00
R7127:Epg5	UTSW	18	78028925	missense	probably damaging	1.00
R7207:Epg5	UTSW	18	77948955	missense	probably damaging	1.00
R7225:Epg5	UTSW	18	78012702	missense	probably benign	0.45
R7358:Epg5	UTSW	18	77959037	missense	possibly damaging	0.78
R7414:Epg5	UTSW	18	77983532	missense	possibly damaging	0.65
R7437:Epg5	UTSW	18	78023278	missense	probably benign	0.01
R7535:Epg5	UTSW	18	78032926	missense	probably benign	0.18
R7586:Epg5	UTSW	18	78030060	missense	probably benign
R7651:Epg5	UTSW	18	77981400	nonsense	probably null
R7715:Epg5	UTSW	18	77968586	missense	probably damaging	1.00
R7753:Epg5	UTSW	18	77948345	missense	possibly damaging	0.92
R7981:Epg5	UTSW	18	78009714	critical splice donor site	probably null
R8114:Epg5	UTSW	18	78030150	missense	probably benign	0.41
R8124:Epg5	UTSW	18	77964996	missense	probably benign	0.05
R8307:Epg5	UTSW	18	78022679	missense	probably damaging	1.00
R8458:Epg5	UTSW	18	77948731	missense	probably benign	0.00
R8751:Epg5	UTSW	18	77965008	missense	probably benign	0.07
R8751:Epg5	UTSW	18	77965009	missense	possibly damaging	0.65
R8751:Epg5	UTSW	18	77965010	missense	probably benign	0.28
R8888:Epg5	UTSW	18	78012871	missense	possibly damaging	0.76
R8971:Epg5	UTSW	18	77979219	missense	probably damaging	1.00
R9045:Epg5	UTSW	18	77948799	missense	probably damaging	1.00
R9291:Epg5	UTSW	18	78012850	nonsense	probably null
R9327:Epg5	UTSW	18	77948220	missense	probably benign	0.00
R9365:Epg5	UTSW	18	77954742	missense	probably damaging	1.00
R9742:Epg5	UTSW	18	77980955	missense	probably damaging	1.00
X0023:Epg5	UTSW	18	77968657	missense	probably damaging	0.99
X0060:Epg5	UTSW	18	77962485	missense	possibly damaging	0.94
Z1088:Epg5	UTSW	18	77959139	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAATCGTACGTCTGTGTTCTGC -3'
(R):5'- TGGGATGCTTAACCACATACTCTC -3'

Sequencing Primer
(F):5'- TGCAGTGTTTTTGTCTACTAACTAC -3'
(R):5'- GATGCTTAACCACATACTCTCACTGG -3'

Posted On

2017-02-28