Incidental Mutation 'R5915:Nfx1'
ID461246
Institutional Source Beutler Lab
Gene Symbol Nfx1
Ensembl Gene ENSMUSG00000028423
Gene Namenuclear transcription factor, X-box binding 1
Synonyms1300017N15Rik, Tex42, 3000003M19Rik, TEG-42
MMRRC Submission 044112-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.525) question?
Stock #R5915 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location40970906-41025993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40977285 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 320 (S320T)
Ref Sequence ENSEMBL: ENSMUSP00000095747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030133] [ENSMUST00000091614] [ENSMUST00000098143]
Predicted Effect probably benign
Transcript: ENSMUST00000030133
AA Change: S320T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000030133
Gene: ENSMUSG00000028423
AA Change: S320T

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091614
AA Change: S320T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000089203
Gene: ENSMUSG00000028423
AA Change: S320T

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098143
AA Change: S320T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000095747
Gene: ENSMUSG00000028423
AA Change: S320T

DomainStartEndE-ValueType
RING 352 402 3.91e-2 SMART
ZnF_NFX 447 465 1.23e-3 SMART
ZnF_NFX 500 519 6.16e-4 SMART
ZnF_NFX 561 580 2e-3 SMART
ZnF_NFX 626 649 5.45e-5 SMART
ZnF_NFX 688 707 5.25e0 SMART
ZnF_NFX 715 734 2.92e-5 SMART
ZnF_NFX 772 791 5.25e0 SMART
ZnF_NFX 826 848 7.7e-5 SMART
ZnF_NFX 857 878 4.23e-2 SMART
coiled coil region 930 956 N/A INTRINSIC
R3H 977 1055 1.38e-22 SMART
low complexity region 1070 1088 N/A INTRINSIC
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MHC class II gene expression is controlled primarily at the transcriptional level by transcription factors that bind to the X and Y boxes, two highly conserved elements in the proximal promoter of MHC class II genes. The protein encoded by this gene is a transcriptional repressor capable of binding to the conserved X box motif of HLA-DRA and other MHC class II genes in vitro. The protein may play a role in regulating the duration of an inflammatory response by limiting the period in which class II MHC molecules are induced by IFN-gamma. Three alternative splice variants, each of which encodes a different isoform, have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,667,163 V940E probably damaging Het
Adgrg7 A T 16: 56,730,385 probably null Het
Alox12e T C 11: 70,318,224 I399V possibly damaging Het
Apoa5 C A 9: 46,269,309 Q42K probably damaging Het
Arfgap1 A G 2: 180,978,422 Y243C possibly damaging Het
Arhgap12 A G 18: 6,037,016 probably null Het
Arl16 G A 11: 120,466,605 probably benign Het
Atp8b5 A G 4: 43,370,577 D951G probably damaging Het
Babam2 T A 5: 31,785,611 L80Q probably damaging Het
Celsr1 C T 15: 85,937,975 V1714I probably benign Het
Celsr1 C T 15: 86,030,349 R1141H probably damaging Het
Cep295 A G 9: 15,341,479 L351P probably damaging Het
Dlc1 T A 8: 36,938,675 probably benign Het
Dpy30 G T 17: 74,315,911 D25E probably benign Het
Drosha T C 15: 12,935,066 W998R probably damaging Het
Fibp A G 19: 5,463,616 D220G possibly damaging Het
Grm3 C T 5: 9,511,927 C641Y probably damaging Het
Gulo A T 14: 66,008,121 V8D probably benign Het
Ifrd1 A T 12: 40,213,096 C164S possibly damaging Het
Jam2 G A 16: 84,809,407 S103N probably benign Het
Krtap17-1 T C 11: 99,993,618 T108A unknown Het
Man2a2 A G 7: 80,360,921 F774S probably benign Het
Map1b G A 13: 99,430,331 R1961W unknown Het
Mib2 A G 4: 155,656,051 probably benign Het
Mr1 A T 1: 155,136,788 F127I probably damaging Het
Mrgprb2 A G 7: 48,552,806 I57T probably benign Het
Ncan G T 8: 70,098,081 Y1154* probably null Het
Nlrp4f A G 13: 65,187,555 L740P probably damaging Het
Nprl2 T C 9: 107,545,078 probably benign Het
Olfr1350 A T 7: 6,570,173 I61F probably benign Het
Opn1sw A G 6: 29,379,755 probably null Het
Palld A G 8: 61,533,352 probably null Het
Phf14 T A 6: 11,933,727 M196K possibly damaging Het
Rnf145 T C 11: 44,542,722 probably null Het
Sbf2 A T 7: 110,378,096 C610* probably null Het
Sec24a C T 11: 51,756,137 A13T probably benign Het
Smim8 TCTCCTC TCTC 4: 34,769,010 probably benign Het
Sox8 A C 17: 25,567,469 L420R probably damaging Het
Sry C G Y: 2,662,612 Q349H unknown Het
Sspo A G 6: 48,464,596 D1889G probably benign Het
Sspo A T 6: 48,491,484 H4382L possibly damaging Het
Tmem65 T C 15: 58,790,188 I141V probably damaging Het
Tpr A T 1: 150,425,649 T1329S probably benign Het
Trim17 C T 11: 58,968,562 R201W probably damaging Het
Trim3 A G 7: 105,617,975 L399P possibly damaging Het
Trim7 A G 11: 48,845,650 D277G possibly damaging Het
Vstm2b A G 7: 40,902,683 N153S possibly damaging Het
Wnk2 G T 13: 49,078,085 Q786K probably damaging Het
Wnk4 A G 11: 101,263,894 *286W probably null Het
Xpot A T 10: 121,615,093 L134Q probably damaging Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zc3h7a G A 16: 11,164,602 Q20* probably null Het
Zfp599 C T 9: 22,249,834 C345Y probably damaging Het
Other mutations in Nfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Nfx1 APN 4 40977241 missense probably benign 0.00
IGL01998:Nfx1 APN 4 41004353 missense probably damaging 1.00
IGL02072:Nfx1 APN 4 41016119 missense probably benign
IGL02170:Nfx1 APN 4 41018019 missense probably damaging 1.00
IGL02188:Nfx1 APN 4 40993827 missense probably damaging 1.00
IGL02502:Nfx1 APN 4 40976345 splice site probably benign
IGL02674:Nfx1 APN 4 40999717 critical splice donor site probably null
IGL03007:Nfx1 APN 4 40984962 missense probably benign 0.02
IGL03092:Nfx1 APN 4 41024851 missense probably damaging 1.00
IGL03303:Nfx1 APN 4 41004323 splice site probably benign
K7371:Nfx1 UTSW 4 40976803 missense probably damaging 1.00
PIT4498001:Nfx1 UTSW 4 40977244 missense probably benign
R0032:Nfx1 UTSW 4 41015321 missense probably benign 0.00
R0032:Nfx1 UTSW 4 41015321 missense probably benign 0.00
R0069:Nfx1 UTSW 4 40986688 splice site probably benign
R1056:Nfx1 UTSW 4 41003057 missense probably damaging 0.97
R1449:Nfx1 UTSW 4 40976803 missense probably damaging 1.00
R1635:Nfx1 UTSW 4 40977004 missense probably benign
R1636:Nfx1 UTSW 4 41016072 splice site probably null
R1882:Nfx1 UTSW 4 41009240 missense possibly damaging 0.55
R2089:Nfx1 UTSW 4 40977004 missense probably benign
R2091:Nfx1 UTSW 4 40977004 missense probably benign
R2091:Nfx1 UTSW 4 40977004 missense probably benign
R3792:Nfx1 UTSW 4 41004357 nonsense probably null
R3793:Nfx1 UTSW 4 41004357 nonsense probably null
R4668:Nfx1 UTSW 4 40976367 missense possibly damaging 0.50
R4678:Nfx1 UTSW 4 41012070 missense probably benign 0.01
R4894:Nfx1 UTSW 4 40996877 missense probably damaging 1.00
R4972:Nfx1 UTSW 4 40976375 missense probably benign 0.36
R5066:Nfx1 UTSW 4 40991868 missense probably benign
R5389:Nfx1 UTSW 4 40985000 missense probably damaging 1.00
R5429:Nfx1 UTSW 4 41004343 missense probably damaging 1.00
R5643:Nfx1 UTSW 4 40984973 missense probably null 1.00
R5644:Nfx1 UTSW 4 40984973 missense probably null 1.00
R6286:Nfx1 UTSW 4 40986728 missense probably damaging 1.00
R6393:Nfx1 UTSW 4 40976851 missense possibly damaging 0.92
R7409:Nfx1 UTSW 4 41021830 missense possibly damaging 0.64
R7523:Nfx1 UTSW 4 41016119 missense probably benign
X0025:Nfx1 UTSW 4 40976422 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGAGCAGAGAAGATATCCCCAG -3'
(R):5'- ACTGTGGAATCCAAGCAGGTAG -3'

Sequencing Primer
(F):5'- AAAGGCCTCCCTGGGAAGTG -3'
(R):5'- TCCAAGCAGGTAGAGATTTCACTGTG -3'
Posted On2017-02-28