Mutagenetix > Incidental Mutation

Incidental Mutation 'R5915:Ncan'

461263

Institutional Source

Beutler Lab

Gene Symbol

Ncan

Ensembl Gene

ENSMUSG00000002341

Gene Name

neurocan

Synonyms

Cspg3, Cspg3-rs, neurocan, Tgfbit

MMRRC Submission

044112-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5915 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70093085-70120873 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 70098081 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1154 (Y1154*)

Ref Sequence

ENSEMBL: ENSMUSP00000002412 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002412]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000002412
AA Change: Y1154*

SMART Domains

Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: Y1154*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	23	30	N/A	INTRINSIC
IG	43	157	9.63e-6	SMART
LINK	157	254	2.22e-56	SMART
LINK	258	356	4.72e-60	SMART
low complexity region	575	586	N/A	INTRINSIC
low complexity region	602	632	N/A	INTRINSIC
low complexity region	663	677	N/A	INTRINSIC
EGF	963	996	6.5e-5	SMART
EGF_CA	998	1034	9.77e-9	SMART
CLECT	1040	1161	1.97e-41	SMART
CCP	1167	1223	2.53e-12	SMART
low complexity region	1225	1256	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184696

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,667,163	V940E	probably damaging	Het
Adgrg7	A	T	16: 56,730,385		probably null	Het
Alox12e	T	C	11: 70,318,224	I399V	possibly damaging	Het
Apoa5	C	A	9: 46,269,309	Q42K	probably damaging	Het
Arfgap1	A	G	2: 180,978,422	Y243C	possibly damaging	Het
Arhgap12	A	G	18: 6,037,016		probably null	Het
Arl16	G	A	11: 120,466,605		probably benign	Het
Atp8b5	A	G	4: 43,370,577	D951G	probably damaging	Het
Babam2	T	A	5: 31,785,611	L80Q	probably damaging	Het
Celsr1	C	T	15: 85,937,975	V1714I	probably benign	Het
Celsr1	C	T	15: 86,030,349	R1141H	probably damaging	Het
Cep295	A	G	9: 15,341,479	L351P	probably damaging	Het
Dlc1	T	A	8: 36,938,675		probably benign	Het
Dpy30	G	T	17: 74,315,911	D25E	probably benign	Het
Drosha	T	C	15: 12,935,066	W998R	probably damaging	Het
Fibp	A	G	19: 5,463,616	D220G	possibly damaging	Het
Grm3	C	T	5: 9,511,927	C641Y	probably damaging	Het
Gulo	A	T	14: 66,008,121	V8D	probably benign	Het
Ifrd1	A	T	12: 40,213,096	C164S	possibly damaging	Het
Jam2	G	A	16: 84,809,407	S103N	probably benign	Het
Krtap17-1	T	C	11: 99,993,618	T108A	unknown	Het
Man2a2	A	G	7: 80,360,921	F774S	probably benign	Het
Map1b	G	A	13: 99,430,331	R1961W	unknown	Het
Mib2	A	G	4: 155,656,051		probably benign	Het
Mr1	A	T	1: 155,136,788	F127I	probably damaging	Het
Mrgprb2	A	G	7: 48,552,806	I57T	probably benign	Het
Nfx1	T	A	4: 40,977,285	S320T	probably benign	Het
Nlrp4f	A	G	13: 65,187,555	L740P	probably damaging	Het
Nprl2	T	C	9: 107,545,078		probably benign	Het
Olfr1350	A	T	7: 6,570,173	I61F	probably benign	Het
Opn1sw	A	G	6: 29,379,755		probably null	Het
Palld	A	G	8: 61,533,352		probably null	Het
Phf14	T	A	6: 11,933,727	M196K	possibly damaging	Het
Rnf145	T	C	11: 44,542,722		probably null	Het
Sbf2	A	T	7: 110,378,096	C610*	probably null	Het
Sec24a	C	T	11: 51,756,137	A13T	probably benign	Het
Smim8	TCTCCTC	TCTC	4: 34,769,010		probably benign	Het
Sox8	A	C	17: 25,567,469	L420R	probably damaging	Het
Sry	C	G	Y: 2,662,612	Q349H	unknown	Het
Sspo	A	G	6: 48,464,596	D1889G	probably benign	Het
Sspo	A	T	6: 48,491,484	H4382L	possibly damaging	Het
Tmem65	T	C	15: 58,790,188	I141V	probably damaging	Het
Tpr	A	T	1: 150,425,649	T1329S	probably benign	Het
Trim17	C	T	11: 58,968,562	R201W	probably damaging	Het
Trim3	A	G	7: 105,617,975	L399P	possibly damaging	Het
Trim7	A	G	11: 48,845,650	D277G	possibly damaging	Het
Vstm2b	A	G	7: 40,902,683	N153S	possibly damaging	Het
Wnk2	G	T	13: 49,078,085	Q786K	probably damaging	Het
Wnk4	A	G	11: 101,263,894	*286W	probably null	Het
Xpot	A	T	10: 121,615,093	L134Q	probably damaging	Het
Ylpm1	C	T	12: 85,040,886	P1148L	probably damaging	Het
Zc3h7a	G	A	16: 11,164,602	Q20*	probably null	Het
Zfp599	C	T	9: 22,249,834	C345Y	probably damaging	Het

Other mutations in Ncan

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00539:Ncan	APN	8	70115271	missense	probably benign	0.24
IGL00924:Ncan	APN	8	70108389	missense	possibly damaging	0.78
IGL01319:Ncan	APN	8	70097562	missense	probably damaging	0.99
IGL01407:Ncan	APN	8	70101957	missense	probably benign	0.17
IGL01528:Ncan	APN	8	70110081	missense	probably benign	0.00
IGL01567:Ncan	APN	8	70108334	missense	probably benign	0.09
IGL01808:Ncan	APN	8	70107440	critical splice donor site	probably null
IGL02543:Ncan	APN	8	70108571	missense	probably benign	0.37
IGL02551:Ncan	APN	8	70102462	missense	probably damaging	1.00
IGL02899:Ncan	APN	8	70115048	missense	possibly damaging	0.95
IGL02940:Ncan	APN	8	70110085	missense	probably benign	0.02
IGL03058:Ncan	APN	8	70107932	missense	possibly damaging	0.83
learned	UTSW	8	70098081	nonsense	probably null
sagacious	UTSW	8	70112590	missense	probably damaging	0.99
R0219:Ncan	UTSW	8	70115334	missense	probably benign	0.08
R0538:Ncan	UTSW	8	70108602	missense	possibly damaging	0.86
R0540:Ncan	UTSW	8	70115159	missense	possibly damaging	0.93
R0854:Ncan	UTSW	8	70112552	missense	probably damaging	1.00
R0918:Ncan	UTSW	8	70108389	missense	possibly damaging	0.78
R1344:Ncan	UTSW	8	70108169	missense	probably benign
R1575:Ncan	UTSW	8	70110198	missense	probably benign	0.27
R1739:Ncan	UTSW	8	70108086	missense	probably benign	0.03
R1847:Ncan	UTSW	8	70102454	missense	probably damaging	0.96
R1859:Ncan	UTSW	8	70115348	missense	possibly damaging	0.94
R2320:Ncan	UTSW	8	70108218	missense	probably benign
R2370:Ncan	UTSW	8	70112813	missense	probably benign	0.05
R3407:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3408:Ncan	UTSW	8	70112151	missense	probably damaging	1.00
R3961:Ncan	UTSW	8	70110300	missense	probably benign	0.05
R4155:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4156:Ncan	UTSW	8	70110077	missense	possibly damaging	0.87
R4365:Ncan	UTSW	8	70115211	missense	probably damaging	1.00
R4858:Ncan	UTSW	8	70104055	missense	probably benign	0.00
R4925:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R4942:Ncan	UTSW	8	70100294	missense	probably damaging	1.00
R4976:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5119:Ncan	UTSW	8	70115025	missense	probably damaging	0.98
R5141:Ncan	UTSW	8	70112837	missense	probably damaging	1.00
R5679:Ncan	UTSW	8	70112626	missense	probably damaging	1.00
R5706:Ncan	UTSW	8	70102017	missense	probably damaging	0.99
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6033:Ncan	UTSW	8	70112590	missense	probably damaging	0.99
R6223:Ncan	UTSW	8	70109954	missense	probably benign	0.02
R6390:Ncan	UTSW	8	70115249	missense	probably benign	0.34
R6533:Ncan	UTSW	8	70096357	missense	probably benign	0.01
R6836:Ncan	UTSW	8	70100315	missense	possibly damaging	0.84
R6869:Ncan	UTSW	8	70107907	missense	probably benign	0.08
R7229:Ncan	UTSW	8	70100311	missense	possibly damaging	0.69
R7232:Ncan	UTSW	8	70112088	missense	probably damaging	1.00
R7293:Ncan	UTSW	8	70115211	missense	probably damaging	0.98
R7406:Ncan	UTSW	8	70110099	missense	probably benign	0.00
R7474:Ncan	UTSW	8	70102041	missense	possibly damaging	0.53
R7779:Ncan	UTSW	8	70115011	missense	probably damaging	0.99
R7973:Ncan	UTSW	8	70097575	missense	probably benign	0.00
R8113:Ncan	UTSW	8	70108571	missense	possibly damaging	0.58
R8269:Ncan	UTSW	8	70107680	missense	probably benign	0.01
R8947:Ncan	UTSW	8	70102521	missense	probably damaging	0.98
R9324:Ncan	UTSW	8	70107998	missense	possibly damaging	0.75
R9717:Ncan	UTSW	8	70101978	missense	probably damaging	1.00
R9803:Ncan	UTSW	8	70108101	missense	probably benign	0.06
Z1177:Ncan	UTSW	8	70097472	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCCTAGGACATAAGGCACAAG -3'
(R):5'- AAGTGCCAAGAACTGGGCTG -3'

Sequencing Primer
(F):5'- CTGGAGCACAAAAGAAAAGTGG -3'
(R):5'- CCAAGAACTGGGCTGACAGC -3'

Posted On

2017-02-28