Mutagenetix > Incidental Mutation

Incidental Mutation 'R5915:Sec24a'

461271

Institutional Source

Beutler Lab

Gene Symbol

Sec24a

Ensembl Gene

ENSMUSG00000036391

Gene Name

Sec24 related gene family, member A (S. cerevisiae)

Synonyms

9430090N21Rik

MMRRC Submission

044112-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5915 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

51692264-51763634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 51756137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 13 (A13T)

Ref Sequence

ENSEMBL: ENSMUSP00000104720 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038210] [ENSMUST00000064297] [ENSMUST00000109092] [ENSMUST00000109097]

AlphaFold

Q3U2P1

Predicted Effect

probably benign
Transcript: ENSMUST00000038210
AA Change: A13T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000044370
Gene: ENSMUSG00000036391
AA Change: A13T

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	71	84	N/A	INTRINSIC
low complexity region	196	235	N/A	INTRINSIC
low complexity region	396	414	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	423	461	8e-19	PFAM
Pfam:Sec23_trunk	497	735	1.2e-87	PFAM
Pfam:Sec23_BS	740	824	1.1e-23	PFAM
Pfam:Sec23_helical	836	938	5.1e-27	PFAM
Pfam:Gelsolin	960	1035	7.2e-15	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000064297
AA Change: A13T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000068065
Gene: ENSMUSG00000036391
AA Change: A13T

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	71	84	N/A	INTRINSIC
low complexity region	196	235	N/A	INTRINSIC
low complexity region	396	414	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	424	462	3.5e-18	PFAM
Pfam:Sec23_trunk	498	589	1.3e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109092
AA Change: A13T

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000104720
Gene: ENSMUSG00000036391
AA Change: A13T

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	71	84	N/A	INTRINSIC
low complexity region	196	235	N/A	INTRINSIC
low complexity region	396	414	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	423	461	3.9e-19	PFAM
Pfam:Sec23_trunk	497	588	1.6e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109097
AA Change: A13T

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000104725
Gene: ENSMUSG00000036391
AA Change: A13T

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	71	84	N/A	INTRINSIC
low complexity region	196	235	N/A	INTRINSIC
low complexity region	396	414	N/A	INTRINSIC
Pfam:zf-Sec23_Sec24	425	462	2.4e-16	PFAM
Pfam:Sec23_trunk	498	736	7.8e-87	PFAM
Pfam:Sec23_BS	741	825	1.1e-22	PFAM
Pfam:Sec23_helical	838	938	6.9e-28	PFAM
Pfam:Gelsolin	961	1036	9.3e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147255

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154325

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins that are homologous to yeast Sec24. This protein is a component of coat protein II (COPII)-coated vesicles that mediate protein transport from the endoplasmic reticulum. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased circulating cholesterol level, decreased circulating LDL cholesterol level, and abnormal liver physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,667,163	V940E	probably damaging	Het
Adgrg7	A	T	16: 56,730,385		probably null	Het
Alox12e	T	C	11: 70,318,224	I399V	possibly damaging	Het
Apoa5	C	A	9: 46,269,309	Q42K	probably damaging	Het
Arfgap1	A	G	2: 180,978,422	Y243C	possibly damaging	Het
Arhgap12	A	G	18: 6,037,016		probably null	Het
Arl16	G	A	11: 120,466,605		probably benign	Het
Atp8b5	A	G	4: 43,370,577	D951G	probably damaging	Het
Babam2	T	A	5: 31,785,611	L80Q	probably damaging	Het
Celsr1	C	T	15: 85,937,975	V1714I	probably benign	Het
Celsr1	C	T	15: 86,030,349	R1141H	probably damaging	Het
Cep295	A	G	9: 15,341,479	L351P	probably damaging	Het
Dlc1	T	A	8: 36,938,675		probably benign	Het
Dpy30	G	T	17: 74,315,911	D25E	probably benign	Het
Drosha	T	C	15: 12,935,066	W998R	probably damaging	Het
Fibp	A	G	19: 5,463,616	D220G	possibly damaging	Het
Grm3	C	T	5: 9,511,927	C641Y	probably damaging	Het
Gulo	A	T	14: 66,008,121	V8D	probably benign	Het
Ifrd1	A	T	12: 40,213,096	C164S	possibly damaging	Het
Jam2	G	A	16: 84,809,407	S103N	probably benign	Het
Krtap17-1	T	C	11: 99,993,618	T108A	unknown	Het
Man2a2	A	G	7: 80,360,921	F774S	probably benign	Het
Map1b	G	A	13: 99,430,331	R1961W	unknown	Het
Mib2	A	G	4: 155,656,051		probably benign	Het
Mr1	A	T	1: 155,136,788	F127I	probably damaging	Het
Mrgprb2	A	G	7: 48,552,806	I57T	probably benign	Het
Ncan	G	T	8: 70,098,081	Y1154*	probably null	Het
Nfx1	T	A	4: 40,977,285	S320T	probably benign	Het
Nlrp4f	A	G	13: 65,187,555	L740P	probably damaging	Het
Nprl2	T	C	9: 107,545,078		probably benign	Het
Olfr1350	A	T	7: 6,570,173	I61F	probably benign	Het
Opn1sw	A	G	6: 29,379,755		probably null	Het
Palld	A	G	8: 61,533,352		probably null	Het
Phf14	T	A	6: 11,933,727	M196K	possibly damaging	Het
Rnf145	T	C	11: 44,542,722		probably null	Het
Sbf2	A	T	7: 110,378,096	C610*	probably null	Het
Smim8	TCTCCTC	TCTC	4: 34,769,010		probably benign	Het
Sox8	A	C	17: 25,567,469	L420R	probably damaging	Het
Sry	C	G	Y: 2,662,612	Q349H	unknown	Het
Sspo	A	G	6: 48,464,596	D1889G	probably benign	Het
Sspo	A	T	6: 48,491,484	H4382L	possibly damaging	Het
Tmem65	T	C	15: 58,790,188	I141V	probably damaging	Het
Tpr	A	T	1: 150,425,649	T1329S	probably benign	Het
Trim17	C	T	11: 58,968,562	R201W	probably damaging	Het
Trim3	A	G	7: 105,617,975	L399P	possibly damaging	Het
Trim7	A	G	11: 48,845,650	D277G	possibly damaging	Het
Vstm2b	A	G	7: 40,902,683	N153S	possibly damaging	Het
Wnk2	G	T	13: 49,078,085	Q786K	probably damaging	Het
Wnk4	A	G	11: 101,263,894	*286W	probably null	Het
Xpot	A	T	10: 121,615,093	L134Q	probably damaging	Het
Ylpm1	C	T	12: 85,040,886	P1148L	probably damaging	Het
Zc3h7a	G	A	16: 11,164,602	Q20*	probably null	Het
Zfp599	C	T	9: 22,249,834	C345Y	probably damaging	Het

Other mutations in Sec24a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00571:Sec24a	APN	11	51736504	nonsense	probably null
IGL00973:Sec24a	APN	11	51729577	critical splice acceptor site	probably null
IGL01364:Sec24a	APN	11	51713529	critical splice donor site	probably null
IGL01476:Sec24a	APN	11	51708956	missense	possibly damaging	0.88
IGL01725:Sec24a	APN	11	51723578	splice site	probably null
IGL02069:Sec24a	APN	11	51733934	splice site	probably benign
IGL02230:Sec24a	APN	11	51709034	missense	possibly damaging	0.88
IGL02617:Sec24a	APN	11	51712187	critical splice donor site	probably null
IGL02655:Sec24a	APN	11	51734655	missense	probably benign	0.43
IGL02756:Sec24a	APN	11	51696733	missense	probably benign	0.02
IGL03396:Sec24a	APN	11	51708967	missense	probably benign	0.17
R0153:Sec24a	UTSW	11	51700826	missense	probably benign	0.08
R0506:Sec24a	UTSW	11	51743795	missense	probably benign	0.03
R0625:Sec24a	UTSW	11	51729454	missense	probably damaging	0.98
R1084:Sec24a	UTSW	11	51713581	missense	probably damaging	1.00
R1166:Sec24a	UTSW	11	51733467	missense	possibly damaging	0.72
R1376:Sec24a	UTSW	11	51700913	splice site	probably benign
R1487:Sec24a	UTSW	11	51731886	missense	possibly damaging	0.92
R1541:Sec24a	UTSW	11	51743796	missense	probably benign	0.41
R1582:Sec24a	UTSW	11	51708967	missense	probably benign	0.17
R1643:Sec24a	UTSW	11	51704385	missense	probably benign	0.03
R1672:Sec24a	UTSW	11	51743948	nonsense	probably null
R1681:Sec24a	UTSW	11	51695189	missense	probably damaging	0.98
R1756:Sec24a	UTSW	11	51733763	splice site	probably benign
R1992:Sec24a	UTSW	11	51736363	missense	probably benign	0.00
R2159:Sec24a	UTSW	11	51712350	missense	probably damaging	1.00
R2177:Sec24a	UTSW	11	51704401	missense	probably benign	0.00
R2188:Sec24a	UTSW	11	51723584	missense	probably damaging	0.99
R2271:Sec24a	UTSW	11	51716450	missense	possibly damaging	0.91
R3414:Sec24a	UTSW	11	51729458	missense	probably damaging	1.00
R4349:Sec24a	UTSW	11	51715149	missense	probably benign	0.03
R4396:Sec24a	UTSW	11	51715164	missense	possibly damaging	0.86
R4629:Sec24a	UTSW	11	51721813	critical splice donor site	probably null
R5061:Sec24a	UTSW	11	51713532	splice site	probably null
R5577:Sec24a	UTSW	11	51734621	missense	probably benign	0.06
R5717:Sec24a	UTSW	11	51707210	missense	probably benign
R6175:Sec24a	UTSW	11	51731891	missense	probably damaging	1.00
R6341:Sec24a	UTSW	11	51717776	missense	probably damaging	0.99
R6461:Sec24a	UTSW	11	51713546	missense	possibly damaging	0.76
R6610:Sec24a	UTSW	11	51696656	missense	probably benign
R6632:Sec24a	UTSW	11	51713649	nonsense	probably null
R6907:Sec24a	UTSW	11	51712276	missense	probably damaging	1.00
R6969:Sec24a	UTSW	11	51700816	missense	probably benign	0.35
R7132:Sec24a	UTSW	11	51715136	nonsense	probably null
R7274:Sec24a	UTSW	11	51707255	missense	probably damaging	1.00
R7475:Sec24a	UTSW	11	51713552	missense	probably damaging	1.00
R7699:Sec24a	UTSW	11	51712257	missense	probably damaging	1.00
R7700:Sec24a	UTSW	11	51712257	missense	probably damaging	1.00
R7935:Sec24a	UTSW	11	51721922	missense	probably benign	0.25
R8042:Sec24a	UTSW	11	51704317	missense	probably benign
R8345:Sec24a	UTSW	11	51743778	missense	probably benign	0.00
R9217:Sec24a	UTSW	11	51726504	missense	probably benign	0.14
R9501:Sec24a	UTSW	11	51712295	missense	probably damaging	1.00
X0025:Sec24a	UTSW	11	51729547	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTGTTTGCAGGCTGAACC -3'
(R):5'- GCCATGCCTCTACTTTGACG -3'

Sequencing Primer
(F):5'- GAAACTGTCCCACCAGCGTG -3'
(R):5'- TTTGACGTGCCACCCCG -3'

Posted On

2017-02-28