Incidental Mutation 'R5915:Alox12e'
ID 461273
Institutional Source Beutler Lab
Gene Symbol Alox12e
Ensembl Gene ENSMUSG00000018907
Gene Name arachidonate lipoxygenase, epidermal
Synonyms 8-LOX, Alox12-ps1, Alox12-ps2, Aloxe, e-LOX1
MMRRC Submission 044112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5915 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 70315610-70322628 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70318224 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 399 (I399V)
Ref Sequence ENSEMBL: ENSMUSP00000019051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019051]
AlphaFold P55249
Predicted Effect possibly damaging
Transcript: ENSMUST00000019051
AA Change: I399V

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000019051
Gene: ENSMUSG00000018907
AA Change: I399V

DomainStartEndE-ValueType
LH2 2 111 9.49e-38 SMART
Pfam:Lipoxygenase 163 649 1.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139899
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149060
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,667,163 V940E probably damaging Het
Adgrg7 A T 16: 56,730,385 probably null Het
Apoa5 C A 9: 46,269,309 Q42K probably damaging Het
Arfgap1 A G 2: 180,978,422 Y243C possibly damaging Het
Arhgap12 A G 18: 6,037,016 probably null Het
Arl16 G A 11: 120,466,605 probably benign Het
Atp8b5 A G 4: 43,370,577 D951G probably damaging Het
Babam2 T A 5: 31,785,611 L80Q probably damaging Het
Celsr1 C T 15: 85,937,975 V1714I probably benign Het
Celsr1 C T 15: 86,030,349 R1141H probably damaging Het
Cep295 A G 9: 15,341,479 L351P probably damaging Het
Dlc1 T A 8: 36,938,675 probably benign Het
Dpy30 G T 17: 74,315,911 D25E probably benign Het
Drosha T C 15: 12,935,066 W998R probably damaging Het
Fibp A G 19: 5,463,616 D220G possibly damaging Het
Grm3 C T 5: 9,511,927 C641Y probably damaging Het
Gulo A T 14: 66,008,121 V8D probably benign Het
Ifrd1 A T 12: 40,213,096 C164S possibly damaging Het
Jam2 G A 16: 84,809,407 S103N probably benign Het
Krtap17-1 T C 11: 99,993,618 T108A unknown Het
Man2a2 A G 7: 80,360,921 F774S probably benign Het
Map1b G A 13: 99,430,331 R1961W unknown Het
Mib2 A G 4: 155,656,051 probably benign Het
Mr1 A T 1: 155,136,788 F127I probably damaging Het
Mrgprb2 A G 7: 48,552,806 I57T probably benign Het
Ncan G T 8: 70,098,081 Y1154* probably null Het
Nfx1 T A 4: 40,977,285 S320T probably benign Het
Nlrp4f A G 13: 65,187,555 L740P probably damaging Het
Nprl2 T C 9: 107,545,078 probably benign Het
Olfr1350 A T 7: 6,570,173 I61F probably benign Het
Opn1sw A G 6: 29,379,755 probably null Het
Palld A G 8: 61,533,352 probably null Het
Phf14 T A 6: 11,933,727 M196K possibly damaging Het
Rnf145 T C 11: 44,542,722 probably null Het
Sbf2 A T 7: 110,378,096 C610* probably null Het
Sec24a C T 11: 51,756,137 A13T probably benign Het
Smim8 TCTCCTC TCTC 4: 34,769,010 probably benign Het
Sox8 A C 17: 25,567,469 L420R probably damaging Het
Sry C G Y: 2,662,612 Q349H unknown Het
Sspo A G 6: 48,464,596 D1889G probably benign Het
Sspo A T 6: 48,491,484 H4382L possibly damaging Het
Tmem65 T C 15: 58,790,188 I141V probably damaging Het
Tpr A T 1: 150,425,649 T1329S probably benign Het
Trim17 C T 11: 58,968,562 R201W probably damaging Het
Trim3 A G 7: 105,617,975 L399P possibly damaging Het
Trim7 A G 11: 48,845,650 D277G possibly damaging Het
Vstm2b A G 7: 40,902,683 N153S possibly damaging Het
Wnk2 G T 13: 49,078,085 Q786K probably damaging Het
Wnk4 A G 11: 101,263,894 *286W probably null Het
Xpot A T 10: 121,615,093 L134Q probably damaging Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zc3h7a G A 16: 11,164,602 Q20* probably null Het
Zfp599 C T 9: 22,249,834 C345Y probably damaging Het
Other mutations in Alox12e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Alox12e APN 11 70321054 missense probably benign
IGL01781:Alox12e APN 11 70321456 missense probably damaging 1.00
R0284:Alox12e UTSW 11 70320899 splice site probably benign
R0417:Alox12e UTSW 11 70321865 missense probably benign 0.12
R0557:Alox12e UTSW 11 70321448 missense possibly damaging 0.80
R0593:Alox12e UTSW 11 70320897 splice site probably benign
R1479:Alox12e UTSW 11 70320782 missense probably benign 0.04
R1967:Alox12e UTSW 11 70317856 missense probably benign 0.18
R1996:Alox12e UTSW 11 70316208 missense probably benign 0.00
R2062:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2063:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2067:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2068:Alox12e UTSW 11 70316002 missense probably damaging 1.00
R2147:Alox12e UTSW 11 70319945 missense probably damaging 1.00
R2307:Alox12e UTSW 11 70321261 missense probably damaging 1.00
R3034:Alox12e UTSW 11 70316253 missense probably benign 0.01
R3739:Alox12e UTSW 11 70319842 missense probably damaging 1.00
R4463:Alox12e UTSW 11 70318256 missense probably damaging 1.00
R4572:Alox12e UTSW 11 70321181 intron probably benign
R5004:Alox12e UTSW 11 70321504 missense probably benign 0.00
R5113:Alox12e UTSW 11 70315995 missense possibly damaging 0.70
R5155:Alox12e UTSW 11 70316255 missense possibly damaging 0.61
R5464:Alox12e UTSW 11 70317679 missense probably damaging 0.99
R5471:Alox12e UTSW 11 70320024 missense probably benign 0.17
R5501:Alox12e UTSW 11 70316229 missense probably benign 0.01
R6033:Alox12e UTSW 11 70316013 missense probably benign 0.03
R6033:Alox12e UTSW 11 70316013 missense probably benign 0.03
R6102:Alox12e UTSW 11 70320023 missense possibly damaging 0.65
R6380:Alox12e UTSW 11 70321101 missense probably benign 0.00
R6452:Alox12e UTSW 11 70320005 missense probably damaging 0.96
R7175:Alox12e UTSW 11 70319708 missense probably damaging 1.00
R7220:Alox12e UTSW 11 70315905 missense probably benign 0.02
R7353:Alox12e UTSW 11 70321435 missense probably damaging 1.00
R7542:Alox12e UTSW 11 70321756 missense possibly damaging 0.69
R7916:Alox12e UTSW 11 70321285 missense probably benign
R8314:Alox12e UTSW 11 70316172 missense possibly damaging 0.83
R8331:Alox12e UTSW 11 70321097 missense probably benign 0.01
R9027:Alox12e UTSW 11 70321774 missense possibly damaging 0.68
R9380:Alox12e UTSW 11 70316168 critical splice donor site probably null
R9641:Alox12e UTSW 11 70321435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCATTCAAGTATGAGGCG -3'
(R):5'- TGACTGCTGGAATTACGATAGC -3'

Sequencing Primer
(F):5'- CCATTCAAGTATGAGGCGAGAGAAG -3'
(R):5'- AGTAGTAAAACCCTGACCCTTTG -3'
Posted On 2017-02-28