Incidental Mutation 'R5915:Map1b'
ID 461282
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, Mtap-5, MAP5, Mtap5, LC1
MMRRC Submission 044112-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5915 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 99557954-99653048 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 99566839 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 1961 (R1961W)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: R1961W
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: R1961W

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224702
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,644,122 (GRCm39) V940E probably damaging Het
Adgrg7 A T 16: 56,550,748 (GRCm39) probably null Het
Alox12e T C 11: 70,209,050 (GRCm39) I399V possibly damaging Het
Apoa5 C A 9: 46,180,607 (GRCm39) Q42K probably damaging Het
Arfgap1 A G 2: 180,620,215 (GRCm39) Y243C possibly damaging Het
Arhgap12 A G 18: 6,037,016 (GRCm39) probably null Het
Arl16 G A 11: 120,357,431 (GRCm39) probably benign Het
Atp8b5 A G 4: 43,370,577 (GRCm39) D951G probably damaging Het
Babam2 T A 5: 31,942,955 (GRCm39) L80Q probably damaging Het
Celsr1 C T 15: 85,822,176 (GRCm39) V1714I probably benign Het
Celsr1 C T 15: 85,914,550 (GRCm39) R1141H probably damaging Het
Cep295 A G 9: 15,252,775 (GRCm39) L351P probably damaging Het
Dlc1 T A 8: 37,405,829 (GRCm39) probably benign Het
Dpy30 G T 17: 74,622,906 (GRCm39) D25E probably benign Het
Drosha T C 15: 12,935,152 (GRCm39) W998R probably damaging Het
Fibp A G 19: 5,513,644 (GRCm39) D220G possibly damaging Het
Grm3 C T 5: 9,561,927 (GRCm39) C641Y probably damaging Het
Gulo A T 14: 66,245,570 (GRCm39) V8D probably benign Het
Ifrd1 A T 12: 40,263,095 (GRCm39) C164S possibly damaging Het
Jam2 G A 16: 84,606,295 (GRCm39) S103N probably benign Het
Krtap17-1 T C 11: 99,884,444 (GRCm39) T108A unknown Het
Man2a2 A G 7: 80,010,669 (GRCm39) F774S probably benign Het
Mib2 A G 4: 155,740,508 (GRCm39) probably benign Het
Mr1 A T 1: 155,012,534 (GRCm39) F127I probably damaging Het
Mrgprb2 A G 7: 48,202,554 (GRCm39) I57T probably benign Het
Ncan G T 8: 70,550,731 (GRCm39) Y1154* probably null Het
Nfx1 T A 4: 40,977,285 (GRCm39) S320T probably benign Het
Nlrp4f A G 13: 65,335,369 (GRCm39) L740P probably damaging Het
Nprl2 T C 9: 107,422,277 (GRCm39) probably benign Het
Opn1sw A G 6: 29,379,754 (GRCm39) probably null Het
Or5bw2 A T 7: 6,573,172 (GRCm39) I61F probably benign Het
Palld A G 8: 61,986,386 (GRCm39) probably null Het
Phf14 T A 6: 11,933,726 (GRCm39) M196K possibly damaging Het
Rnf145 T C 11: 44,433,549 (GRCm39) probably null Het
Sbf2 A T 7: 109,977,303 (GRCm39) C610* probably null Het
Sec24a C T 11: 51,646,964 (GRCm39) A13T probably benign Het
Smim8 TCTCCTC TCTC 4: 34,769,010 (GRCm39) probably benign Het
Sox8 A C 17: 25,786,443 (GRCm39) L420R probably damaging Het
Sry C G Y: 2,662,612 (GRCm39) Q349H unknown Het
Sspo A G 6: 48,441,530 (GRCm39) D1889G probably benign Het
Sspo A T 6: 48,468,418 (GRCm39) H4382L possibly damaging Het
Tmem65 T C 15: 58,662,037 (GRCm39) I141V probably damaging Het
Tpr A T 1: 150,301,400 (GRCm39) T1329S probably benign Het
Trim17 C T 11: 58,859,388 (GRCm39) R201W probably damaging Het
Trim3 A G 7: 105,267,182 (GRCm39) L399P possibly damaging Het
Trim7 A G 11: 48,736,477 (GRCm39) D277G possibly damaging Het
Vstm2b A G 7: 40,552,107 (GRCm39) N153S possibly damaging Het
Wnk2 G T 13: 49,231,561 (GRCm39) Q786K probably damaging Het
Wnk4 A G 11: 101,154,720 (GRCm39) *286W probably null Het
Xpot A T 10: 121,450,998 (GRCm39) L134Q probably damaging Het
Ylpm1 C T 12: 85,087,660 (GRCm39) P1148L probably damaging Het
Zc3h7a G A 16: 10,982,466 (GRCm39) Q20* probably null Het
Zfp599 C T 9: 22,161,130 (GRCm39) C345Y probably damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99,565,741 (GRCm39) missense unknown
IGL00533:Map1b APN 13 99,569,112 (GRCm39) missense unknown
IGL00801:Map1b APN 13 99,566,605 (GRCm39) missense unknown
IGL01141:Map1b APN 13 99,571,269 (GRCm39) missense probably damaging 1.00
IGL01418:Map1b APN 13 99,568,338 (GRCm39) missense unknown
IGL01464:Map1b APN 13 99,569,251 (GRCm39) missense unknown
IGL01690:Map1b APN 13 99,571,512 (GRCm39) missense probably damaging 1.00
IGL01991:Map1b APN 13 99,566,077 (GRCm39) missense unknown
IGL02245:Map1b APN 13 99,568,036 (GRCm39) missense unknown
IGL02376:Map1b APN 13 99,572,103 (GRCm39) missense probably damaging 1.00
IGL02380:Map1b APN 13 99,567,651 (GRCm39) missense unknown
IGL02442:Map1b APN 13 99,644,706 (GRCm39) missense probably damaging 1.00
IGL02465:Map1b APN 13 99,569,914 (GRCm39) missense unknown
IGL02816:Map1b APN 13 99,578,263 (GRCm39) missense probably damaging 1.00
IGL02859:Map1b APN 13 99,569,544 (GRCm39) missense unknown
IGL02934:Map1b APN 13 99,571,639 (GRCm39) missense probably benign 0.09
IGL02970:Map1b APN 13 99,567,242 (GRCm39) nonsense probably null
IGL03148:Map1b APN 13 99,578,203 (GRCm39) missense probably damaging 1.00
IGL03401:Map1b APN 13 99,563,776 (GRCm39) missense unknown
IGL03138:Map1b UTSW 13 99,562,334 (GRCm39) missense unknown
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0035:Map1b UTSW 13 99,571,846 (GRCm39) missense probably damaging 1.00
R0069:Map1b UTSW 13 99,566,356 (GRCm39) missense unknown
R0315:Map1b UTSW 13 99,567,624 (GRCm39) missense unknown
R0539:Map1b UTSW 13 99,570,526 (GRCm39) missense unknown
R0548:Map1b UTSW 13 99,568,191 (GRCm39) missense unknown
R0613:Map1b UTSW 13 99,578,149 (GRCm39) missense probably damaging 1.00
R0730:Map1b UTSW 13 99,566,274 (GRCm39) nonsense probably null
R1103:Map1b UTSW 13 99,563,974 (GRCm39) splice site probably benign
R1300:Map1b UTSW 13 99,569,029 (GRCm39) missense unknown
R1353:Map1b UTSW 13 99,563,834 (GRCm39) missense unknown
R1387:Map1b UTSW 13 99,569,158 (GRCm39) missense unknown
R1481:Map1b UTSW 13 99,567,679 (GRCm39) missense unknown
R1509:Map1b UTSW 13 99,568,036 (GRCm39) missense unknown
R1521:Map1b UTSW 13 99,569,247 (GRCm39) missense unknown
R1604:Map1b UTSW 13 99,566,080 (GRCm39) missense unknown
R1649:Map1b UTSW 13 99,652,986 (GRCm39) missense probably benign 0.03
R1651:Map1b UTSW 13 99,569,091 (GRCm39) missense unknown
R1661:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1665:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1770:Map1b UTSW 13 99,567,001 (GRCm39) missense unknown
R1926:Map1b UTSW 13 99,567,200 (GRCm39) missense unknown
R1928:Map1b UTSW 13 99,567,454 (GRCm39) missense unknown
R2093:Map1b UTSW 13 99,566,178 (GRCm39) missense unknown
R2110:Map1b UTSW 13 99,567,629 (GRCm39) missense unknown
R2116:Map1b UTSW 13 99,567,152 (GRCm39) missense unknown
R2164:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R2207:Map1b UTSW 13 99,567,591 (GRCm39) missense unknown
R2273:Map1b UTSW 13 99,568,592 (GRCm39) missense unknown
R2443:Map1b UTSW 13 99,566,919 (GRCm39) missense unknown
R3054:Map1b UTSW 13 99,569,250 (GRCm39) missense unknown
R3766:Map1b UTSW 13 99,570,595 (GRCm39) missense unknown
R3911:Map1b UTSW 13 99,567,580 (GRCm39) missense unknown
R4005:Map1b UTSW 13 99,566,415 (GRCm39) missense unknown
R4130:Map1b UTSW 13 99,568,188 (GRCm39) missense unknown
R4513:Map1b UTSW 13 99,580,741 (GRCm39) missense probably damaging 1.00
R4613:Map1b UTSW 13 99,566,810 (GRCm39) nonsense probably null
R4633:Map1b UTSW 13 99,571,450 (GRCm39) missense probably damaging 1.00
R4646:Map1b UTSW 13 99,568,977 (GRCm39) missense unknown
R4690:Map1b UTSW 13 99,567,576 (GRCm39) missense unknown
R4704:Map1b UTSW 13 99,566,983 (GRCm39) missense unknown
R4836:Map1b UTSW 13 99,567,562 (GRCm39) missense unknown
R4916:Map1b UTSW 13 99,569,808 (GRCm39) missense unknown
R4951:Map1b UTSW 13 99,568,935 (GRCm39) missense unknown
R4960:Map1b UTSW 13 99,568,720 (GRCm39) missense probably benign 0.23
R4961:Map1b UTSW 13 99,572,161 (GRCm39) missense probably damaging 1.00
R5030:Map1b UTSW 13 99,570,682 (GRCm39) missense unknown
R5090:Map1b UTSW 13 99,566,534 (GRCm39) nonsense probably null
R5469:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R5820:Map1b UTSW 13 99,569,332 (GRCm39) missense unknown
R5885:Map1b UTSW 13 99,566,589 (GRCm39) missense unknown
R5923:Map1b UTSW 13 99,569,661 (GRCm39) missense unknown
R6063:Map1b UTSW 13 99,567,645 (GRCm39) missense unknown
R6102:Map1b UTSW 13 99,562,381 (GRCm39) missense unknown
R6218:Map1b UTSW 13 99,569,714 (GRCm39) missense unknown
R6435:Map1b UTSW 13 99,652,871 (GRCm39) missense probably damaging 0.99
R6663:Map1b UTSW 13 99,566,530 (GRCm39) missense unknown
R6765:Map1b UTSW 13 99,562,449 (GRCm39) missense unknown
R6860:Map1b UTSW 13 99,571,275 (GRCm39) missense probably damaging 1.00
R6997:Map1b UTSW 13 99,567,142 (GRCm39) missense unknown
R7001:Map1b UTSW 13 99,567,101 (GRCm39) missense unknown
R7310:Map1b UTSW 13 99,570,163 (GRCm39) missense unknown
R7349:Map1b UTSW 13 99,570,148 (GRCm39) missense unknown
R7448:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7449:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7452:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7810:Map1b UTSW 13 99,568,390 (GRCm39) missense unknown
R7820:Map1b UTSW 13 99,567,685 (GRCm39) missense unknown
R8396:Map1b UTSW 13 99,570,621 (GRCm39) missense unknown
R8470:Map1b UTSW 13 99,652,950 (GRCm39) missense probably damaging 0.98
R8535:Map1b UTSW 13 99,571,662 (GRCm39) missense probably damaging 1.00
R8777:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8777-TAIL:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8812:Map1b UTSW 13 99,569,323 (GRCm39) missense unknown
R8903:Map1b UTSW 13 99,569,017 (GRCm39) nonsense probably null
R8928:Map1b UTSW 13 99,568,624 (GRCm39) missense unknown
R8954:Map1b UTSW 13 99,570,735 (GRCm39) missense unknown
R9164:Map1b UTSW 13 99,568,816 (GRCm39) nonsense probably null
R9164:Map1b UTSW 13 99,562,351 (GRCm39) missense unknown
R9190:Map1b UTSW 13 99,571,914 (GRCm39) missense probably damaging 0.99
R9334:Map1b UTSW 13 99,568,148 (GRCm39) missense unknown
R9339:Map1b UTSW 13 99,567,570 (GRCm39) missense unknown
R9357:Map1b UTSW 13 99,566,708 (GRCm39) nonsense probably null
R9430:Map1b UTSW 13 99,570,616 (GRCm39) missense unknown
RF003:Map1b UTSW 13 99,567,258 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,568,920 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,566,476 (GRCm39) missense unknown
Z1088:Map1b UTSW 13 99,644,623 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGCTTTCAGACTCAGGAAAGC -3'
(R):5'- CCGGATCTCCAGATGAAGAAG -3'

Sequencing Primer
(F):5'- CTCAGGAAAGCTGGTAATTTTCTCAG -3'
(R):5'- CACGACGTGGGTGGTTACTAC -3'
Posted On 2017-02-28