Mutagenetix > Incidental Mutation

Incidental Mutation 'R5915:Map1b'

461282

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

044112-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5915 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 99430331 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 1961 (R1961W)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: R1961W

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: R1961W

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,667,163	V940E	probably damaging	Het
Adgrg7	A	T	16: 56,730,385		probably null	Het
Alox12e	T	C	11: 70,318,224	I399V	possibly damaging	Het
Apoa5	C	A	9: 46,269,309	Q42K	probably damaging	Het
Arfgap1	A	G	2: 180,978,422	Y243C	possibly damaging	Het
Arhgap12	A	G	18: 6,037,016		probably null	Het
Arl16	G	A	11: 120,466,605		probably benign	Het
Atp8b5	A	G	4: 43,370,577	D951G	probably damaging	Het
Babam2	T	A	5: 31,785,611	L80Q	probably damaging	Het
Celsr1	C	T	15: 85,937,975	V1714I	probably benign	Het
Celsr1	C	T	15: 86,030,349	R1141H	probably damaging	Het
Cep295	A	G	9: 15,341,479	L351P	probably damaging	Het
Dlc1	T	A	8: 36,938,675		probably benign	Het
Dpy30	G	T	17: 74,315,911	D25E	probably benign	Het
Drosha	T	C	15: 12,935,066	W998R	probably damaging	Het
Fibp	A	G	19: 5,463,616	D220G	possibly damaging	Het
Grm3	C	T	5: 9,511,927	C641Y	probably damaging	Het
Gulo	A	T	14: 66,008,121	V8D	probably benign	Het
Ifrd1	A	T	12: 40,213,096	C164S	possibly damaging	Het
Jam2	G	A	16: 84,809,407	S103N	probably benign	Het
Krtap17-1	T	C	11: 99,993,618	T108A	unknown	Het
Man2a2	A	G	7: 80,360,921	F774S	probably benign	Het
Mib2	A	G	4: 155,656,051		probably benign	Het
Mr1	A	T	1: 155,136,788	F127I	probably damaging	Het
Mrgprb2	A	G	7: 48,552,806	I57T	probably benign	Het
Ncan	G	T	8: 70,098,081	Y1154*	probably null	Het
Nfx1	T	A	4: 40,977,285	S320T	probably benign	Het
Nlrp4f	A	G	13: 65,187,555	L740P	probably damaging	Het
Nprl2	T	C	9: 107,545,078		probably benign	Het
Olfr1350	A	T	7: 6,570,173	I61F	probably benign	Het
Opn1sw	A	G	6: 29,379,755		probably null	Het
Palld	A	G	8: 61,533,352		probably null	Het
Phf14	T	A	6: 11,933,727	M196K	possibly damaging	Het
Rnf145	T	C	11: 44,542,722		probably null	Het
Sbf2	A	T	7: 110,378,096	C610*	probably null	Het
Sec24a	C	T	11: 51,756,137	A13T	probably benign	Het
Smim8	TCTCCTC	TCTC	4: 34,769,010		probably benign	Het
Sox8	A	C	17: 25,567,469	L420R	probably damaging	Het
Sry	C	G	Y: 2,662,612	Q349H	unknown	Het
Sspo	A	G	6: 48,464,596	D1889G	probably benign	Het
Sspo	A	T	6: 48,491,484	H4382L	possibly damaging	Het
Tmem65	T	C	15: 58,790,188	I141V	probably damaging	Het
Tpr	A	T	1: 150,425,649	T1329S	probably benign	Het
Trim17	C	T	11: 58,968,562	R201W	probably damaging	Het
Trim3	A	G	7: 105,617,975	L399P	possibly damaging	Het
Trim7	A	G	11: 48,845,650	D277G	possibly damaging	Het
Vstm2b	A	G	7: 40,902,683	N153S	possibly damaging	Het
Wnk2	G	T	13: 49,078,085	Q786K	probably damaging	Het
Wnk4	A	G	11: 101,263,894	*286W	probably null	Het
Xpot	A	T	10: 121,615,093	L134Q	probably damaging	Het
Ylpm1	C	T	12: 85,040,886	P1148L	probably damaging	Het
Zc3h7a	G	A	16: 11,164,602	Q20*	probably null	Het
Zfp599	C	T	9: 22,249,834	C345Y	probably damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- AGCTTTCAGACTCAGGAAAGC -3'
(R):5'- CCGGATCTCCAGATGAAGAAG -3'

Sequencing Primer
(F):5'- CTCAGGAAAGCTGGTAATTTTCTCAG -3'
(R):5'- CACGACGTGGGTGGTTACTAC -3'

Posted On

2017-02-28