Incidental Mutation 'R5915:Gulo'
ID 461283
Institutional Source Beutler Lab
Gene Symbol Gulo
Ensembl Gene ENSMUSG00000034450
Gene Name gulonolactone (L-) oxidase
Synonyms sfx, L-gulono-gamma-lactone oxidase
MMRRC Submission 044112-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R5915 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 66224235-66246656 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 66245570 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 8 (V8D)
Ref Sequence ENSEMBL: ENSMUSP00000060912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059970]
AlphaFold P58710
Predicted Effect probably benign
Transcript: ENSMUST00000059970
AA Change: V8D

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000060912
Gene: ENSMUSG00000034450
AA Change: V8D

DomainStartEndE-ValueType
Pfam:FAD_binding_4 21 156 7.6e-36 PFAM
Pfam:ALO 180 438 2.8e-92 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Homozygotes for spontaneous mutations exhibit impaired growth and mobility, decreased spleen and thymus weights, reduced serum calcium, phosphate, alkaline phosphatase, IGF1, and osteocalcin levels, and small, fragile and histologically abnormal bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,644,122 (GRCm39) V940E probably damaging Het
Adgrg7 A T 16: 56,550,748 (GRCm39) probably null Het
Alox12e T C 11: 70,209,050 (GRCm39) I399V possibly damaging Het
Apoa5 C A 9: 46,180,607 (GRCm39) Q42K probably damaging Het
Arfgap1 A G 2: 180,620,215 (GRCm39) Y243C possibly damaging Het
Arhgap12 A G 18: 6,037,016 (GRCm39) probably null Het
Arl16 G A 11: 120,357,431 (GRCm39) probably benign Het
Atp8b5 A G 4: 43,370,577 (GRCm39) D951G probably damaging Het
Babam2 T A 5: 31,942,955 (GRCm39) L80Q probably damaging Het
Celsr1 C T 15: 85,822,176 (GRCm39) V1714I probably benign Het
Celsr1 C T 15: 85,914,550 (GRCm39) R1141H probably damaging Het
Cep295 A G 9: 15,252,775 (GRCm39) L351P probably damaging Het
Dlc1 T A 8: 37,405,829 (GRCm39) probably benign Het
Dpy30 G T 17: 74,622,906 (GRCm39) D25E probably benign Het
Drosha T C 15: 12,935,152 (GRCm39) W998R probably damaging Het
Fibp A G 19: 5,513,644 (GRCm39) D220G possibly damaging Het
Grm3 C T 5: 9,561,927 (GRCm39) C641Y probably damaging Het
Ifrd1 A T 12: 40,263,095 (GRCm39) C164S possibly damaging Het
Jam2 G A 16: 84,606,295 (GRCm39) S103N probably benign Het
Krtap17-1 T C 11: 99,884,444 (GRCm39) T108A unknown Het
Man2a2 A G 7: 80,010,669 (GRCm39) F774S probably benign Het
Map1b G A 13: 99,566,839 (GRCm39) R1961W unknown Het
Mib2 A G 4: 155,740,508 (GRCm39) probably benign Het
Mr1 A T 1: 155,012,534 (GRCm39) F127I probably damaging Het
Mrgprb2 A G 7: 48,202,554 (GRCm39) I57T probably benign Het
Ncan G T 8: 70,550,731 (GRCm39) Y1154* probably null Het
Nfx1 T A 4: 40,977,285 (GRCm39) S320T probably benign Het
Nlrp4f A G 13: 65,335,369 (GRCm39) L740P probably damaging Het
Nprl2 T C 9: 107,422,277 (GRCm39) probably benign Het
Opn1sw A G 6: 29,379,754 (GRCm39) probably null Het
Or5bw2 A T 7: 6,573,172 (GRCm39) I61F probably benign Het
Palld A G 8: 61,986,386 (GRCm39) probably null Het
Phf14 T A 6: 11,933,726 (GRCm39) M196K possibly damaging Het
Rnf145 T C 11: 44,433,549 (GRCm39) probably null Het
Sbf2 A T 7: 109,977,303 (GRCm39) C610* probably null Het
Sec24a C T 11: 51,646,964 (GRCm39) A13T probably benign Het
Smim8 TCTCCTC TCTC 4: 34,769,010 (GRCm39) probably benign Het
Sox8 A C 17: 25,786,443 (GRCm39) L420R probably damaging Het
Sry C G Y: 2,662,612 (GRCm39) Q349H unknown Het
Sspo A G 6: 48,441,530 (GRCm39) D1889G probably benign Het
Sspo A T 6: 48,468,418 (GRCm39) H4382L possibly damaging Het
Tmem65 T C 15: 58,662,037 (GRCm39) I141V probably damaging Het
Tpr A T 1: 150,301,400 (GRCm39) T1329S probably benign Het
Trim17 C T 11: 58,859,388 (GRCm39) R201W probably damaging Het
Trim3 A G 7: 105,267,182 (GRCm39) L399P possibly damaging Het
Trim7 A G 11: 48,736,477 (GRCm39) D277G possibly damaging Het
Vstm2b A G 7: 40,552,107 (GRCm39) N153S possibly damaging Het
Wnk2 G T 13: 49,231,561 (GRCm39) Q786K probably damaging Het
Wnk4 A G 11: 101,154,720 (GRCm39) *286W probably null Het
Xpot A T 10: 121,450,998 (GRCm39) L134Q probably damaging Het
Ylpm1 C T 12: 85,087,660 (GRCm39) P1148L probably damaging Het
Zc3h7a G A 16: 10,982,466 (GRCm39) Q20* probably null Het
Zfp599 C T 9: 22,161,130 (GRCm39) C345Y probably damaging Het
Other mutations in Gulo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Gulo APN 14 66,243,398 (GRCm39) missense probably damaging 1.00
IGL01736:Gulo APN 14 66,234,325 (GRCm39) missense probably benign 0.24
R0599:Gulo UTSW 14 66,227,890 (GRCm39) missense probably damaging 1.00
R2014:Gulo UTSW 14 66,246,496 (GRCm39) start codon destroyed probably benign
R2058:Gulo UTSW 14 66,228,608 (GRCm39) missense possibly damaging 0.51
R2079:Gulo UTSW 14 66,227,832 (GRCm39) missense probably damaging 1.00
R2405:Gulo UTSW 14 66,228,477 (GRCm39) critical splice donor site probably null
R4196:Gulo UTSW 14 66,225,702 (GRCm39) missense possibly damaging 0.49
R4807:Gulo UTSW 14 66,227,833 (GRCm39) missense probably benign 0.00
R5341:Gulo UTSW 14 66,225,707 (GRCm39) missense probably benign 0.12
R5913:Gulo UTSW 14 66,237,470 (GRCm39) critical splice acceptor site probably null
R6328:Gulo UTSW 14 66,240,080 (GRCm39) missense probably damaging 1.00
R6628:Gulo UTSW 14 66,241,619 (GRCm39) missense probably benign 0.00
R7725:Gulo UTSW 14 66,245,522 (GRCm39) missense probably damaging 0.99
R7935:Gulo UTSW 14 66,237,288 (GRCm39) missense probably benign
R8720:Gulo UTSW 14 66,225,074 (GRCm39) missense probably benign 0.01
R8940:Gulo UTSW 14 66,235,040 (GRCm39) missense probably benign 0.04
R9458:Gulo UTSW 14 66,235,043 (GRCm39) missense probably benign 0.01
R9716:Gulo UTSW 14 66,234,348 (GRCm39) missense probably benign 0.00
R9746:Gulo UTSW 14 66,225,630 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACATTACAACAGGCTGCGGAG -3'
(R):5'- TGGCCCTTGACCTAAGAACC -3'

Sequencing Primer
(F):5'- GGAAGAAGAGCCTTGCCTTTACC -3'
(R):5'- GGCCCTTGACCTAAGAACCATAGTAG -3'
Posted On 2017-02-28