Incidental Mutation 'R5915:Celsr1'
ID 461287
Institutional Source Beutler Lab
Gene Symbol Celsr1
Ensembl Gene ENSMUSG00000016028
Gene Name cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms Scy, Adgrc1, Crsh, crash
MMRRC Submission 044112-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.634) question?
Stock # R5915 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 85783130-85918404 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 85914550 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 1141 (R1141H)
Ref Sequence ENSEMBL: ENSMUSP00000016172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000016172
AA Change: R1141H

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: R1141H

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,644,122 (GRCm39) V940E probably damaging Het
Adgrg7 A T 16: 56,550,748 (GRCm39) probably null Het
Alox12e T C 11: 70,209,050 (GRCm39) I399V possibly damaging Het
Apoa5 C A 9: 46,180,607 (GRCm39) Q42K probably damaging Het
Arfgap1 A G 2: 180,620,215 (GRCm39) Y243C possibly damaging Het
Arhgap12 A G 18: 6,037,016 (GRCm39) probably null Het
Arl16 G A 11: 120,357,431 (GRCm39) probably benign Het
Atp8b5 A G 4: 43,370,577 (GRCm39) D951G probably damaging Het
Babam2 T A 5: 31,942,955 (GRCm39) L80Q probably damaging Het
Cep295 A G 9: 15,252,775 (GRCm39) L351P probably damaging Het
Dlc1 T A 8: 37,405,829 (GRCm39) probably benign Het
Dpy30 G T 17: 74,622,906 (GRCm39) D25E probably benign Het
Drosha T C 15: 12,935,152 (GRCm39) W998R probably damaging Het
Fibp A G 19: 5,513,644 (GRCm39) D220G possibly damaging Het
Grm3 C T 5: 9,561,927 (GRCm39) C641Y probably damaging Het
Gulo A T 14: 66,245,570 (GRCm39) V8D probably benign Het
Ifrd1 A T 12: 40,263,095 (GRCm39) C164S possibly damaging Het
Jam2 G A 16: 84,606,295 (GRCm39) S103N probably benign Het
Krtap17-1 T C 11: 99,884,444 (GRCm39) T108A unknown Het
Man2a2 A G 7: 80,010,669 (GRCm39) F774S probably benign Het
Map1b G A 13: 99,566,839 (GRCm39) R1961W unknown Het
Mib2 A G 4: 155,740,508 (GRCm39) probably benign Het
Mr1 A T 1: 155,012,534 (GRCm39) F127I probably damaging Het
Mrgprb2 A G 7: 48,202,554 (GRCm39) I57T probably benign Het
Ncan G T 8: 70,550,731 (GRCm39) Y1154* probably null Het
Nfx1 T A 4: 40,977,285 (GRCm39) S320T probably benign Het
Nlrp4f A G 13: 65,335,369 (GRCm39) L740P probably damaging Het
Nprl2 T C 9: 107,422,277 (GRCm39) probably benign Het
Opn1sw A G 6: 29,379,754 (GRCm39) probably null Het
Or5bw2 A T 7: 6,573,172 (GRCm39) I61F probably benign Het
Palld A G 8: 61,986,386 (GRCm39) probably null Het
Phf14 T A 6: 11,933,726 (GRCm39) M196K possibly damaging Het
Rnf145 T C 11: 44,433,549 (GRCm39) probably null Het
Sbf2 A T 7: 109,977,303 (GRCm39) C610* probably null Het
Sec24a C T 11: 51,646,964 (GRCm39) A13T probably benign Het
Smim8 TCTCCTC TCTC 4: 34,769,010 (GRCm39) probably benign Het
Sox8 A C 17: 25,786,443 (GRCm39) L420R probably damaging Het
Sry C G Y: 2,662,612 (GRCm39) Q349H unknown Het
Sspo A G 6: 48,441,530 (GRCm39) D1889G probably benign Het
Sspo A T 6: 48,468,418 (GRCm39) H4382L possibly damaging Het
Tmem65 T C 15: 58,662,037 (GRCm39) I141V probably damaging Het
Tpr A T 1: 150,301,400 (GRCm39) T1329S probably benign Het
Trim17 C T 11: 58,859,388 (GRCm39) R201W probably damaging Het
Trim3 A G 7: 105,267,182 (GRCm39) L399P possibly damaging Het
Trim7 A G 11: 48,736,477 (GRCm39) D277G possibly damaging Het
Vstm2b A G 7: 40,552,107 (GRCm39) N153S possibly damaging Het
Wnk2 G T 13: 49,231,561 (GRCm39) Q786K probably damaging Het
Wnk4 A G 11: 101,154,720 (GRCm39) *286W probably null Het
Xpot A T 10: 121,450,998 (GRCm39) L134Q probably damaging Het
Ylpm1 C T 12: 85,087,660 (GRCm39) P1148L probably damaging Het
Zc3h7a G A 16: 10,982,466 (GRCm39) Q20* probably null Het
Zfp599 C T 9: 22,161,130 (GRCm39) C345Y probably damaging Het
Other mutations in Celsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Celsr1 APN 15 85,815,546 (GRCm39) missense probably benign 0.04
IGL00519:Celsr1 APN 15 85,915,037 (GRCm39) missense probably damaging 1.00
IGL00909:Celsr1 APN 15 85,806,436 (GRCm39) missense probably damaging 1.00
IGL01303:Celsr1 APN 15 85,914,692 (GRCm39) missense probably damaging 0.97
IGL01726:Celsr1 APN 15 85,810,391 (GRCm39) missense probably benign 0.35
IGL01910:Celsr1 APN 15 85,814,096 (GRCm39) missense probably benign
IGL01931:Celsr1 APN 15 85,791,861 (GRCm39) missense probably damaging 1.00
IGL01952:Celsr1 APN 15 85,847,424 (GRCm39) missense probably benign 0.35
IGL02090:Celsr1 APN 15 85,791,922 (GRCm39) missense possibly damaging 0.49
IGL02191:Celsr1 APN 15 85,863,205 (GRCm39) missense possibly damaging 0.69
IGL02372:Celsr1 APN 15 85,814,108 (GRCm39) missense probably benign 0.01
IGL02413:Celsr1 APN 15 85,915,427 (GRCm39) missense possibly damaging 0.96
IGL02478:Celsr1 APN 15 85,825,337 (GRCm39) missense possibly damaging 0.68
IGL02507:Celsr1 APN 15 85,784,889 (GRCm39) utr 3 prime probably benign
IGL02508:Celsr1 APN 15 85,914,818 (GRCm39) nonsense probably null
IGL02899:Celsr1 APN 15 85,915,927 (GRCm39) missense probably damaging 0.98
IGL02939:Celsr1 APN 15 85,785,673 (GRCm39) missense probably benign
IGL03212:Celsr1 APN 15 85,814,878 (GRCm39) missense probably benign 0.04
P0028:Celsr1 UTSW 15 85,806,436 (GRCm39) missense probably damaging 1.00
PIT4305001:Celsr1 UTSW 15 85,785,138 (GRCm39) missense possibly damaging 0.87
PIT4480001:Celsr1 UTSW 15 85,916,615 (GRCm39) missense probably damaging 0.99
R0018:Celsr1 UTSW 15 85,915,243 (GRCm39) missense possibly damaging 0.47
R0018:Celsr1 UTSW 15 85,915,243 (GRCm39) missense possibly damaging 0.47
R0038:Celsr1 UTSW 15 85,813,620 (GRCm39) missense possibly damaging 0.65
R0057:Celsr1 UTSW 15 85,914,963 (GRCm39) missense probably benign 0.02
R0060:Celsr1 UTSW 15 85,806,399 (GRCm39) missense probably damaging 0.98
R0060:Celsr1 UTSW 15 85,806,399 (GRCm39) missense probably damaging 0.98
R0279:Celsr1 UTSW 15 85,787,065 (GRCm39) missense probably benign 0.00
R0570:Celsr1 UTSW 15 85,787,566 (GRCm39) missense probably benign 0.18
R0611:Celsr1 UTSW 15 85,816,524 (GRCm39) missense possibly damaging 0.91
R0731:Celsr1 UTSW 15 85,785,798 (GRCm39) missense probably benign
R0792:Celsr1 UTSW 15 85,815,477 (GRCm39) missense probably benign 0.02
R0943:Celsr1 UTSW 15 85,787,489 (GRCm39) missense probably damaging 1.00
R0989:Celsr1 UTSW 15 85,915,480 (GRCm39) missense probably benign 0.39
R1118:Celsr1 UTSW 15 85,916,248 (GRCm39) missense probably damaging 1.00
R1237:Celsr1 UTSW 15 85,788,175 (GRCm39) missense probably benign 0.01
R1239:Celsr1 UTSW 15 85,863,347 (GRCm39) missense probably damaging 0.99
R1405:Celsr1 UTSW 15 85,789,635 (GRCm39) splice site probably null
R1405:Celsr1 UTSW 15 85,789,635 (GRCm39) splice site probably null
R1522:Celsr1 UTSW 15 85,815,477 (GRCm39) missense probably benign 0.02
R1662:Celsr1 UTSW 15 85,915,263 (GRCm39) missense probably damaging 1.00
R1673:Celsr1 UTSW 15 85,816,658 (GRCm39) missense probably benign 0.00
R1795:Celsr1 UTSW 15 85,914,524 (GRCm39) missense probably damaging 0.99
R1799:Celsr1 UTSW 15 85,916,886 (GRCm39) missense probably damaging 1.00
R1858:Celsr1 UTSW 15 85,916,960 (GRCm39) missense probably damaging 1.00
R2040:Celsr1 UTSW 15 85,917,088 (GRCm39) missense probably damaging 1.00
R2050:Celsr1 UTSW 15 85,914,748 (GRCm39) missense probably benign 0.02
R2131:Celsr1 UTSW 15 85,847,424 (GRCm39) missense probably benign 0.35
R2132:Celsr1 UTSW 15 85,916,168 (GRCm39) missense possibly damaging 0.91
R2189:Celsr1 UTSW 15 85,863,431 (GRCm39) missense possibly damaging 0.93
R2192:Celsr1 UTSW 15 85,800,924 (GRCm39) missense possibly damaging 0.93
R4213:Celsr1 UTSW 15 85,916,008 (GRCm39) missense probably damaging 1.00
R4356:Celsr1 UTSW 15 85,863,028 (GRCm39) missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85,812,200 (GRCm39) missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85,847,334 (GRCm39) missense probably benign 0.00
R4416:Celsr1 UTSW 15 85,812,200 (GRCm39) missense probably damaging 1.00
R4645:Celsr1 UTSW 15 85,800,957 (GRCm39) missense probably benign 0.35
R4666:Celsr1 UTSW 15 85,914,695 (GRCm39) missense probably damaging 1.00
R4687:Celsr1 UTSW 15 85,816,661 (GRCm39) missense possibly damaging 0.94
R4735:Celsr1 UTSW 15 85,790,230 (GRCm39) critical splice acceptor site probably null
R4804:Celsr1 UTSW 15 85,822,154 (GRCm39) missense possibly damaging 0.49
R4995:Celsr1 UTSW 15 85,822,112 (GRCm39) missense probably damaging 0.99
R5070:Celsr1 UTSW 15 85,823,335 (GRCm39) missense possibly damaging 0.89
R5218:Celsr1 UTSW 15 85,816,585 (GRCm39) missense probably damaging 1.00
R5280:Celsr1 UTSW 15 85,814,747 (GRCm39) missense probably benign
R5310:Celsr1 UTSW 15 85,810,423 (GRCm39) missense possibly damaging 0.88
R5388:Celsr1 UTSW 15 85,809,719 (GRCm39) missense probably damaging 0.99
R5484:Celsr1 UTSW 15 85,815,483 (GRCm39) missense probably benign 0.00
R5639:Celsr1 UTSW 15 85,914,968 (GRCm39) missense probably damaging 1.00
R5758:Celsr1 UTSW 15 85,825,465 (GRCm39) missense probably benign 0.27
R5778:Celsr1 UTSW 15 85,917,156 (GRCm39) missense probably damaging 1.00
R5893:Celsr1 UTSW 15 85,788,215 (GRCm39) missense probably benign 0.02
R5915:Celsr1 UTSW 15 85,822,176 (GRCm39) missense probably benign
R5932:Celsr1 UTSW 15 85,916,905 (GRCm39) missense probably damaging 1.00
R5950:Celsr1 UTSW 15 85,916,701 (GRCm39) missense probably damaging 1.00
R5975:Celsr1 UTSW 15 85,803,239 (GRCm39) splice site probably null
R6050:Celsr1 UTSW 15 85,814,812 (GRCm39) missense probably benign 0.00
R6117:Celsr1 UTSW 15 85,816,612 (GRCm39) missense probably benign 0.04
R6178:Celsr1 UTSW 15 85,785,222 (GRCm39) missense probably benign 0.08
R6186:Celsr1 UTSW 15 85,805,394 (GRCm39) missense possibly damaging 0.84
R6212:Celsr1 UTSW 15 85,800,888 (GRCm39) missense probably benign 0.25
R6307:Celsr1 UTSW 15 85,812,531 (GRCm39) missense probably benign
R6320:Celsr1 UTSW 15 85,785,160 (GRCm39) missense probably benign 0.13
R6349:Celsr1 UTSW 15 85,915,885 (GRCm39) missense probably damaging 1.00
R6478:Celsr1 UTSW 15 85,809,719 (GRCm39) missense probably damaging 0.99
R6504:Celsr1 UTSW 15 85,863,121 (GRCm39) missense probably benign 0.07
R6607:Celsr1 UTSW 15 85,847,486 (GRCm39) missense probably benign
R6615:Celsr1 UTSW 15 85,786,315 (GRCm39) critical splice donor site probably null
R6661:Celsr1 UTSW 15 85,803,135 (GRCm39) missense probably damaging 1.00
R6722:Celsr1 UTSW 15 85,790,115 (GRCm39) critical splice donor site probably null
R6743:Celsr1 UTSW 15 85,791,799 (GRCm39) missense probably damaging 0.96
R6746:Celsr1 UTSW 15 85,915,696 (GRCm39) missense probably damaging 1.00
R6772:Celsr1 UTSW 15 85,914,983 (GRCm39) missense probably benign
R6838:Celsr1 UTSW 15 85,823,395 (GRCm39) missense probably benign
R6886:Celsr1 UTSW 15 85,915,855 (GRCm39) missense probably benign 0.00
R7030:Celsr1 UTSW 15 85,789,679 (GRCm39) missense probably damaging 0.99
R7060:Celsr1 UTSW 15 85,916,856 (GRCm39) missense probably benign 0.07
R7080:Celsr1 UTSW 15 85,816,652 (GRCm39) missense possibly damaging 0.87
R7325:Celsr1 UTSW 15 85,917,209 (GRCm39) missense probably damaging 0.99
R7357:Celsr1 UTSW 15 85,914,715 (GRCm39) missense probably benign 0.00
R7371:Celsr1 UTSW 15 85,914,875 (GRCm39) missense possibly damaging 0.91
R7446:Celsr1 UTSW 15 85,791,874 (GRCm39) missense possibly damaging 0.95
R7465:Celsr1 UTSW 15 85,917,593 (GRCm39) missense probably benign
R7491:Celsr1 UTSW 15 85,916,719 (GRCm39) missense possibly damaging 0.78
R7639:Celsr1 UTSW 15 85,814,073 (GRCm39) missense probably benign 0.00
R7685:Celsr1 UTSW 15 85,862,933 (GRCm39) nonsense probably null
R7741:Celsr1 UTSW 15 85,863,303 (GRCm39) missense possibly damaging 0.94
R7768:Celsr1 UTSW 15 85,816,610 (GRCm39) missense probably benign
R7974:Celsr1 UTSW 15 85,915,231 (GRCm39) missense probably damaging 1.00
R7977:Celsr1 UTSW 15 85,917,194 (GRCm39) missense probably damaging 1.00
R7987:Celsr1 UTSW 15 85,917,194 (GRCm39) missense probably damaging 1.00
R8073:Celsr1 UTSW 15 85,823,356 (GRCm39) missense probably benign 0.00
R8099:Celsr1 UTSW 15 85,915,801 (GRCm39) missense probably damaging 0.99
R8190:Celsr1 UTSW 15 85,787,090 (GRCm39) missense probably damaging 0.99
R8210:Celsr1 UTSW 15 85,863,436 (GRCm39) missense probably benign 0.00
R8289:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8290:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8292:Celsr1 UTSW 15 85,791,819 (GRCm39) missense possibly damaging 0.90
R8328:Celsr1 UTSW 15 85,806,445 (GRCm39) missense probably benign 0.00
R8330:Celsr1 UTSW 15 85,816,501 (GRCm39) missense probably damaging 0.99
R8333:Celsr1 UTSW 15 85,915,615 (GRCm39) missense possibly damaging 0.65
R8352:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8384:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8452:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8463:Celsr1 UTSW 15 85,914,415 (GRCm39) missense probably damaging 1.00
R8479:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8480:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8493:Celsr1 UTSW 15 85,822,207 (GRCm39) missense possibly damaging 0.67
R8498:Celsr1 UTSW 15 85,823,306 (GRCm39) missense probably benign 0.01
R8506:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8771:Celsr1 UTSW 15 85,788,175 (GRCm39) missense probably benign 0.01
R8891:Celsr1 UTSW 15 85,822,194 (GRCm39) missense probably benign 0.01
R8905:Celsr1 UTSW 15 85,788,269 (GRCm39) intron probably benign
R8924:Celsr1 UTSW 15 85,916,671 (GRCm39) missense possibly damaging 0.94
R8979:Celsr1 UTSW 15 85,847,340 (GRCm39) missense probably damaging 0.96
R9069:Celsr1 UTSW 15 85,914,772 (GRCm39) missense possibly damaging 0.53
R9115:Celsr1 UTSW 15 85,803,217 (GRCm39) missense probably damaging 1.00
R9194:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9196:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9198:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9200:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9201:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9202:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9203:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9222:Celsr1 UTSW 15 85,815,471 (GRCm39) missense possibly damaging 0.68
R9236:Celsr1 UTSW 15 85,915,051 (GRCm39) missense probably damaging 1.00
R9384:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9386:Celsr1 UTSW 15 85,863,231 (GRCm39) missense probably damaging 1.00
R9400:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9401:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9415:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9428:Celsr1 UTSW 15 85,815,549 (GRCm39) missense possibly damaging 0.64
R9435:Celsr1 UTSW 15 85,806,535 (GRCm39) splice site probably benign
R9493:Celsr1 UTSW 15 85,785,346 (GRCm39) missense probably damaging 0.98
R9495:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9499:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9607:Celsr1 UTSW 15 85,915,229 (GRCm39) missense
R9673:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
Z1176:Celsr1 UTSW 15 85,847,301 (GRCm39) missense probably damaging 0.96
Z1177:Celsr1 UTSW 15 85,863,052 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTCTAAGCATGCCCAGG -3'
(R):5'- TGGACCTACTGAGTGGTGAC -3'

Sequencing Primer
(F):5'- AGGTTCTCTGGGAGTCCC -3'
(R):5'- TACTGAGTGGTGACCTCCG -3'
Posted On 2017-02-28