Incidental Mutation 'R5915:Fibp'
ID461295
Institutional Source Beutler Lab
Gene Symbol Fibp
Ensembl Gene ENSMUSG00000024911
Gene Namefibroblast growth factor (acidic) intracellular binding protein
Synonyms
MMRRC Submission 044112-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.295) question?
Stock #R5915 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5460616-5465051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5463616 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 220 (D220G)
Ref Sequence ENSEMBL: ENSMUSP00000153409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025844] [ENSMUST00000025847] [ENSMUST00000225141]
Predicted Effect probably benign
Transcript: ENSMUST00000025844
SMART Domains Protein: ENSMUSP00000025844
Gene: ENSMUSG00000024910

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Inhibitor_I29 40 97 2.21e-12 SMART
Pept_C1 126 357 1.58e-79 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000025847
AA Change: D227G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025847
Gene: ENSMUSG00000024911
AA Change: D227G

DomainStartEndE-ValueType
Pfam:FIBP 3 363 7.6e-171 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224005
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224944
Predicted Effect possibly damaging
Transcript: ENSMUST00000225141
AA Change: D220G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226017
Meta Mutation Damage Score 0.1698 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acidic fibroblast growth factor is mitogenic for a variety of different cell types and acts by stimulating mitogenesis or inducing morphological changes and differentiation. The FIBP protein is an intracellular protein that binds selectively to acidic fibroblast growth factor (aFGF). It is postulated that FIBP may be involved in the mitogenic action of aFGF. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T A 6: 121,667,163 V940E probably damaging Het
Adgrg7 A T 16: 56,730,385 probably null Het
Alox12e T C 11: 70,318,224 I399V possibly damaging Het
Apoa5 C A 9: 46,269,309 Q42K probably damaging Het
Arfgap1 A G 2: 180,978,422 Y243C possibly damaging Het
Arhgap12 A G 18: 6,037,016 probably null Het
Arl16 G A 11: 120,466,605 probably benign Het
Atp8b5 A G 4: 43,370,577 D951G probably damaging Het
Babam2 T A 5: 31,785,611 L80Q probably damaging Het
Celsr1 C T 15: 85,937,975 V1714I probably benign Het
Celsr1 C T 15: 86,030,349 R1141H probably damaging Het
Cep295 A G 9: 15,341,479 L351P probably damaging Het
Dlc1 T A 8: 36,938,675 probably benign Het
Dpy30 G T 17: 74,315,911 D25E probably benign Het
Drosha T C 15: 12,935,066 W998R probably damaging Het
Grm3 C T 5: 9,511,927 C641Y probably damaging Het
Gulo A T 14: 66,008,121 V8D probably benign Het
Ifrd1 A T 12: 40,213,096 C164S possibly damaging Het
Jam2 G A 16: 84,809,407 S103N probably benign Het
Krtap17-1 T C 11: 99,993,618 T108A unknown Het
Man2a2 A G 7: 80,360,921 F774S probably benign Het
Map1b G A 13: 99,430,331 R1961W unknown Het
Mib2 A G 4: 155,656,051 probably benign Het
Mr1 A T 1: 155,136,788 F127I probably damaging Het
Mrgprb2 A G 7: 48,552,806 I57T probably benign Het
Ncan G T 8: 70,098,081 Y1154* probably null Het
Nfx1 T A 4: 40,977,285 S320T probably benign Het
Nlrp4f A G 13: 65,187,555 L740P probably damaging Het
Nprl2 T C 9: 107,545,078 probably benign Het
Olfr1350 A T 7: 6,570,173 I61F probably benign Het
Opn1sw A G 6: 29,379,755 probably null Het
Palld A G 8: 61,533,352 probably null Het
Phf14 T A 6: 11,933,727 M196K possibly damaging Het
Rnf145 T C 11: 44,542,722 probably null Het
Sbf2 A T 7: 110,378,096 C610* probably null Het
Sec24a C T 11: 51,756,137 A13T probably benign Het
Smim8 TCTCCTC TCTC 4: 34,769,010 probably benign Het
Sox8 A C 17: 25,567,469 L420R probably damaging Het
Sry C G Y: 2,662,612 Q349H unknown Het
Sspo A G 6: 48,464,596 D1889G probably benign Het
Sspo A T 6: 48,491,484 H4382L possibly damaging Het
Tmem65 T C 15: 58,790,188 I141V probably damaging Het
Tpr A T 1: 150,425,649 T1329S probably benign Het
Trim17 C T 11: 58,968,562 R201W probably damaging Het
Trim3 A G 7: 105,617,975 L399P possibly damaging Het
Trim7 A G 11: 48,845,650 D277G possibly damaging Het
Vstm2b A G 7: 40,902,683 N153S possibly damaging Het
Wnk2 G T 13: 49,078,085 Q786K probably damaging Het
Wnk4 A G 11: 101,263,894 *286W probably null Het
Xpot A T 10: 121,615,093 L134Q probably damaging Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zc3h7a G A 16: 11,164,602 Q20* probably null Het
Zfp599 C T 9: 22,249,834 C345Y probably damaging Het
Other mutations in Fibp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02246:Fibp APN 19 5463236 missense probably damaging 1.00
R0539:Fibp UTSW 19 5463188 missense probably damaging 1.00
R1350:Fibp UTSW 19 5461391 missense probably damaging 1.00
R1708:Fibp UTSW 19 5463794 missense probably null 1.00
R4021:Fibp UTSW 19 5460734 splice site probably null
R5556:Fibp UTSW 19 5464199 missense possibly damaging 0.74
R5932:Fibp UTSW 19 5464425 missense probably benign 0.01
R7083:Fibp UTSW 19 5463631 missense probably damaging 1.00
R7131:Fibp UTSW 19 5461491 missense probably damaging 0.97
R7762:Fibp UTSW 19 5464174 missense probably benign 0.12
R8465:Fibp UTSW 19 5463187 missense probably damaging 1.00
R8758:Fibp UTSW 19 5464942 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TAGCGTATAGATAGCTTCCACAG -3'
(R):5'- ACCAGGCTGTAGGAAGATGC -3'

Sequencing Primer
(F):5'- ACCTCTACGGATAGTCCCCTGG -3'
(R):5'- GCAGTTATGTCTCTAGCCGACTAAG -3'
Posted On2017-02-28