Incidental Mutation 'R5916:Or4f57'
ID 461308
Institutional Source Beutler Lab
Gene Symbol Or4f57
Ensembl Gene ENSMUSG00000074952
Gene Name olfactory receptor family 4 subfamily F member 57
Synonyms MOR245-22, Olfr1308, GA_x6K02T2Q125-73008844-73007882
MMRRC Submission 044113-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.093) question?
Stock # R5916 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 111790454-111791416 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111791175 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 81 (M81T)
Ref Sequence ENSEMBL: ENSMUSP00000146688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099605] [ENSMUST00000207560]
AlphaFold Q7TQX0
Predicted Effect probably damaging
Transcript: ENSMUST00000099605
AA Change: M81T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097200
Gene: ENSMUSG00000074952
AA Change: M81T

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-39 PFAM
Pfam:7tm_1 41 287 3.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000207560
AA Change: M81T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,349,550 (GRCm39) N269I possibly damaging Het
Abcc1 G T 16: 14,283,006 (GRCm39) V1161F possibly damaging Het
Adam3 A T 8: 25,174,555 (GRCm39) probably null Het
Agt A T 8: 125,290,597 (GRCm39) S237T possibly damaging Het
Ano3 A T 2: 110,512,181 (GRCm39) F674L probably benign Het
Asb2 G T 12: 103,290,135 (GRCm39) A504E probably damaging Het
Atp13a1 T A 8: 70,259,748 (GRCm39) I1113N probably damaging Het
Atxn7l2 T C 3: 108,112,978 (GRCm39) probably null Het
Bambi A G 18: 3,511,463 (GRCm39) T95A probably benign Het
Cfap210 A T 2: 69,619,806 (GRCm39) M1K probably null Het
Clrn1 T C 3: 58,753,783 (GRCm39) T193A probably benign Het
Colgalt2 T A 1: 152,379,873 (GRCm39) D437E probably damaging Het
Dchs1 C A 7: 105,408,373 (GRCm39) A1820S probably damaging Het
Dnah12 T A 14: 26,428,073 (GRCm39) I233N possibly damaging Het
Dsc3 T C 18: 20,120,077 (GRCm39) N194D probably damaging Het
Dync2h1 A G 9: 7,102,309 (GRCm39) probably null Het
Erich3 A T 3: 154,401,460 (GRCm39) R36S probably damaging Het
Fam243 T A 16: 92,117,559 (GRCm39) E243V probably damaging Het
Fmnl3 A T 15: 99,219,709 (GRCm39) C680S probably damaging Het
Focad T C 4: 88,275,778 (GRCm39) L1129P unknown Het
Fzd3 G A 14: 65,440,178 (GRCm39) T664I probably benign Het
Glb1l3 T C 9: 26,766,032 (GRCm39) I129V probably benign Het
Heatr1 T C 13: 12,449,352 (GRCm39) F1950S probably damaging Het
Herc6 G A 6: 57,623,188 (GRCm39) G597E probably benign Het
Hmcn2 T A 2: 31,286,151 (GRCm39) V2101D probably damaging Het
Il17re T A 6: 113,447,084 (GRCm39) C612S probably damaging Het
Il36g T G 2: 24,082,806 (GRCm39) *194E probably null Het
Junb T C 8: 85,704,505 (GRCm39) Y185C probably benign Het
Lrriq1 G A 10: 103,057,243 (GRCm39) Q186* probably null Het
Lrrn2 T A 1: 132,865,538 (GRCm39) V201E probably damaging Het
Ly6l A T 15: 75,323,027 (GRCm39) T68S probably benign Het
Marchf1 G T 8: 66,839,763 (GRCm39) R182L possibly damaging Het
Megf6 A G 4: 154,333,882 (GRCm39) probably null Het
Mga T A 2: 119,794,793 (GRCm39) S2708T probably benign Het
Mx1 T C 16: 97,252,933 (GRCm39) T396A probably benign Het
Naip5 A C 13: 100,359,209 (GRCm39) S676A probably benign Het
Npepl1 G T 2: 173,963,337 (GRCm39) W456C probably benign Het
Ntrk2 A G 13: 58,956,543 (GRCm39) M1V probably null Het
Nufip1 T C 14: 76,372,340 (GRCm39) *485Q probably null Het
Ocln T G 13: 100,642,687 (GRCm39) D216A possibly damaging Het
Or10x1 A T 1: 174,196,698 (GRCm39) T72S probably damaging Het
Or1o11 C T 17: 37,756,570 (GRCm39) L53F probably benign Het
Or55b4 G A 7: 102,133,586 (GRCm39) S247F probably damaging Het
Ptprq A T 10: 107,359,374 (GRCm39) M2243K probably damaging Het
Rad51b C T 12: 79,371,856 (GRCm39) Q190* probably null Het
Resf1 C T 6: 149,228,076 (GRCm39) T374I probably damaging Het
Rfx8 T C 1: 39,727,779 (GRCm39) Y182C probably benign Het
Rpgrip1l C A 8: 91,979,541 (GRCm39) R967L possibly damaging Het
Scube2 A G 7: 109,430,931 (GRCm39) Y423H possibly damaging Het
Sipa1l2 A T 8: 126,195,312 (GRCm39) Y809N probably damaging Het
Slc35f1 C A 10: 52,809,317 (GRCm39) Y101* probably null Het
Tbc1d22a A G 15: 86,098,809 (GRCm39) K12E possibly damaging Het
Tent2 T C 13: 93,312,055 (GRCm39) D215G probably damaging Het
Tmcc2 C T 1: 132,285,429 (GRCm39) V646M probably damaging Het
Tpp1 A T 7: 105,398,587 (GRCm39) M243K probably damaging Het
Trappc12 A G 12: 28,741,513 (GRCm39) L732P probably damaging Het
U2af2 A T 7: 5,082,179 (GRCm39) probably null Het
Utrn T A 10: 12,540,795 (GRCm39) N1877Y probably damaging Het
Vsir C T 10: 60,193,816 (GRCm39) T93I probably damaging Het
Zkscan5 T A 5: 145,142,112 (GRCm39) M3K possibly damaging Het
Zscan29 G T 2: 120,994,518 (GRCm39) T489N probably damaging Het
Other mutations in Or4f57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Or4f57 APN 2 111,790,620 (GRCm39) missense possibly damaging 0.84
IGL01359:Or4f57 APN 2 111,791,406 (GRCm39) missense probably benign
IGL01731:Or4f57 APN 2 111,790,980 (GRCm39) missense probably benign 0.03
IGL01788:Or4f57 APN 2 111,791,352 (GRCm39) missense probably benign
IGL02385:Or4f57 APN 2 111,790,603 (GRCm39) missense probably benign 0.00
IGL02969:Or4f57 APN 2 111,790,912 (GRCm39) missense probably damaging 1.00
R0102:Or4f57 UTSW 2 111,790,942 (GRCm39) missense probably damaging 1.00
R0102:Or4f57 UTSW 2 111,790,942 (GRCm39) missense probably damaging 1.00
R0244:Or4f57 UTSW 2 111,791,361 (GRCm39) missense probably benign 0.13
R0265:Or4f57 UTSW 2 111,790,839 (GRCm39) missense probably damaging 0.99
R1268:Or4f57 UTSW 2 111,791,222 (GRCm39) missense possibly damaging 0.78
R1406:Or4f57 UTSW 2 111,790,926 (GRCm39) missense probably benign 0.07
R1406:Or4f57 UTSW 2 111,790,926 (GRCm39) missense probably benign 0.07
R1568:Or4f57 UTSW 2 111,790,585 (GRCm39) missense probably benign 0.02
R2401:Or4f57 UTSW 2 111,790,494 (GRCm39) missense probably benign 0.01
R4396:Or4f57 UTSW 2 111,790,560 (GRCm39) missense probably damaging 1.00
R4528:Or4f57 UTSW 2 111,791,293 (GRCm39) missense probably damaging 1.00
R6332:Or4f57 UTSW 2 111,791,091 (GRCm39) missense probably damaging 0.98
R6595:Or4f57 UTSW 2 111,790,515 (GRCm39) missense possibly damaging 0.95
R7339:Or4f57 UTSW 2 111,790,956 (GRCm39) missense probably benign 0.12
R7917:Or4f57 UTSW 2 111,791,310 (GRCm39) missense probably damaging 0.98
R8017:Or4f57 UTSW 2 111,790,918 (GRCm39) missense probably damaging 0.99
R8092:Or4f57 UTSW 2 111,790,652 (GRCm39) missense probably benign 0.00
R8246:Or4f57 UTSW 2 111,790,483 (GRCm39) missense probably benign 0.05
R9389:Or4f57 UTSW 2 111,790,872 (GRCm39) missense probably damaging 1.00
R9515:Or4f57 UTSW 2 111,790,584 (GRCm39) missense possibly damaging 0.54
R9631:Or4f57 UTSW 2 111,791,377 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AAACAAGATGCACATCCTTGGG -3'
(R):5'- GTTTGTGTTCCTGGGACTCACC -3'

Sequencing Primer
(F):5'- CACATCCTTGGGCTCATAATGATTAG -3'
(R):5'- CTGGGACTCACCAACTCTTG -3'
Posted On 2017-02-28