Incidental Mutation 'R0565:Upb1'
ID46132
Institutional Source Beutler Lab
Gene Symbol Upb1
Ensembl Gene ENSMUSG00000033427
Gene Nameureidopropionase, beta
Synonyms
MMRRC Submission 038756-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0565 (G1)
Quality Score161
Status Validated
Chromosome10
Chromosomal Location75401115-75441679 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 75428354 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039925] [ENSMUST00000145890] [ENSMUST00000219052]
Predicted Effect probably benign
Transcript: ENSMUST00000039925
SMART Domains Protein: ENSMUSP00000049342
Gene: ENSMUSG00000033427

DomainStartEndE-ValueType
Pfam:CN_hydrolase 73 352 8.3e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129946
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132629
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138058
Predicted Effect probably benign
Transcript: ENSMUST00000145890
SMART Domains Protein: ENSMUSP00000123254
Gene: ENSMUSG00000033416

DomainStartEndE-ValueType
Pfam:Peptidase_C39_2 20 206 2.6e-10 PFAM
Pfam:Guanylate_cyc_2 22 210 4e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153125
SMART Domains Protein: ENSMUSP00000117061
Gene: ENSMUSG00000033416

DomainStartEndE-ValueType
Pfam:Guanylate_cyc_2 2 91 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219052
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: This gene encodes an enzyme that catalyzes the conversion of N-carbamyl-beta-aminoisobutyric acid and N-carbamyl-beta-alanine to beta-aminoisobutyric acid or beta-alanine. Mutations in the related gene in human have been associated with beta-ureidopropionase deficiency. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A T 16: 4,864,336 H1010L probably benign Het
A2ml1 C A 6: 128,568,743 E474* probably null Het
Agtr1b T C 3: 20,315,674 H256R probably damaging Het
Amacr C T 15: 10,981,946 A46V possibly damaging Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Caskin2 T C 11: 115,801,016 E981G probably damaging Het
Ccdc88a A G 11: 29,461,042 probably benign Het
Cd180 A G 13: 102,702,874 probably benign Het
Cemip G A 7: 83,964,110 H627Y probably damaging Het
Cep131 G T 11: 120,073,762 H289Q probably damaging Het
Cep350 G A 1: 155,961,195 probably benign Het
Cfap52 A T 11: 67,949,599 C169S probably benign Het
Cps1 A T 1: 67,166,449 T544S possibly damaging Het
Cul7 T C 17: 46,652,003 S187P probably damaging Het
Dhx40 C A 11: 86,771,167 R688L probably damaging Het
E330034G19Rik C A 14: 24,306,917 Q174K probably benign Het
Efna5 T C 17: 62,881,036 Y32C probably damaging Het
Ethe1 A G 7: 24,607,889 H176R probably benign Het
Exoc3 A G 13: 74,182,275 probably null Het
Fam135b T A 15: 71,490,837 N232Y possibly damaging Het
Fam214b A T 4: 43,034,647 probably benign Het
Fndc9 C T 11: 46,238,157 L168F probably damaging Het
Fpr-rs3 G A 17: 20,624,021 A286V probably damaging Het
Gm609 T A 16: 45,444,173 probably benign Het
Immt T A 6: 71,846,483 probably benign Het
Ipo7 T C 7: 110,049,593 probably benign Het
Ipo8 A T 6: 148,786,723 L747H probably damaging Het
Ireb2 A T 9: 54,899,983 N610Y probably damaging Het
Irs2 A G 8: 11,004,592 V1280A probably damaging Het
Kcnj3 T A 2: 55,595,264 M458K probably benign Het
Kl A G 5: 150,980,944 K387R possibly damaging Het
L3mbtl2 C A 15: 81,684,286 probably benign Het
Lamb1 A C 12: 31,298,915 I649L probably benign Het
Lipm A C 19: 34,116,506 L274F probably benign Het
Lrfn3 A G 7: 30,360,791 V3A probably benign Het
Lrrc8c A C 5: 105,607,028 D223A probably damaging Het
Ltn1 C A 16: 87,416,010 K554N probably benign Het
Mertk T C 2: 128,771,483 I473T probably benign Het
Mfsd12 C A 10: 81,361,409 N245K probably benign Het
Mmp16 A G 4: 17,987,705 D89G probably damaging Het
Myo5a T A 9: 75,180,112 N1083K probably benign Het
Ncapd3 C T 9: 27,087,998 A1290V probably benign Het
Nefm A G 14: 68,124,621 S65P probably damaging Het
Nt5c2 C T 19: 46,897,625 R220H probably damaging Het
Olfr1189 T A 2: 88,592,009 D68E probably benign Het
Osbpl1a A T 18: 12,759,444 S438R probably damaging Het
Pcdhb5 T C 18: 37,320,767 S67P possibly damaging Het
Per3 A T 4: 151,033,952 I228N probably damaging Het
Pnpla7 T G 2: 24,980,117 probably benign Het
Ppp1r15b G T 1: 133,136,653 probably benign Het
Psmd2 G T 16: 20,660,426 L678F probably null Het
Ptch2 A G 4: 117,106,143 probably benign Het
Ranbp2 T A 10: 58,476,336 D959E probably benign Het
Rph3al C T 11: 75,833,401 probably null Het
Sec31b T A 19: 44,524,553 E499V probably damaging Het
Sel1l T C 12: 91,811,889 I667M probably benign Het
Sel1l C A 12: 91,813,945 V641L possibly damaging Het
Slc7a1 T A 5: 148,352,069 I123F probably damaging Het
Smarca2 G A 19: 26,681,875 R855Q possibly damaging Het
Sphk1 G T 11: 116,536,358 probably benign Het
Spink12 C A 18: 44,104,688 S11* probably null Het
Sstr2 A T 11: 113,625,619 I342F probably benign Het
Stxbp1 T C 2: 32,819,848 T78A probably benign Het
Trim11 T A 11: 58,990,584 S434R probably damaging Het
Ubr2 T C 17: 46,955,886 E1113G probably damaging Het
Vit T A 17: 78,624,837 C458S probably damaging Het
Vmn1r58 T C 7: 5,411,166 I22V probably benign Het
Vps25 T C 11: 101,258,905 probably benign Het
Wbp2 G T 11: 116,082,385 D65E possibly damaging Het
Wdr72 A G 9: 74,217,306 D980G probably benign Het
Xkr8 A C 4: 132,730,917 probably null Het
Other mutations in Upb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0419:Upb1 UTSW 10 75412883 missense probably damaging 1.00
R0450:Upb1 UTSW 10 75415083 splice site probably null
R0469:Upb1 UTSW 10 75415083 splice site probably null
R1109:Upb1 UTSW 10 75438165 missense probably damaging 1.00
R1439:Upb1 UTSW 10 75439942 missense probably benign
R2001:Upb1 UTSW 10 75429969 missense probably damaging 1.00
R2074:Upb1 UTSW 10 75424513 missense probably damaging 1.00
R2254:Upb1 UTSW 10 75436217 missense probably damaging 1.00
R2255:Upb1 UTSW 10 75436217 missense probably damaging 1.00
R3773:Upb1 UTSW 10 75439838 intron probably null
R4696:Upb1 UTSW 10 75415027 missense probably benign 0.22
R5157:Upb1 UTSW 10 75412804 missense possibly damaging 0.78
R5723:Upb1 UTSW 10 75428271 missense probably damaging 0.99
R6292:Upb1 UTSW 10 75438171 missense probably damaging 1.00
R6335:Upb1 UTSW 10 75428301 missense probably benign 0.09
R6577:Upb1 UTSW 10 75412889 missense probably damaging 1.00
R6756:Upb1 UTSW 10 75428301 missense possibly damaging 0.78
R6765:Upb1 UTSW 10 75438144 missense probably damaging 1.00
R7069:Upb1 UTSW 10 75412768 missense probably benign 0.00
R7094:Upb1 UTSW 10 75438208 missense probably damaging 1.00
R7609:Upb1 UTSW 10 75436201 missense probably benign 0.31
R7617:Upb1 UTSW 10 75424534 missense probably benign 0.22
R7836:Upb1 UTSW 10 75412833 nonsense probably null
R7919:Upb1 UTSW 10 75412833 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACATGGTGGTGGTGTCTCCAATC -3'
(R):5'- AGCTCAGAGTCCCTTCATAAGCCC -3'

Sequencing Primer
(F):5'- TCCAATCTTGGAGCGTGATAGAG -3'
(R):5'- ACCGGAGTCATTTCACATTTG -3'
Posted On2013-06-11