Mutagenetix > Incidental Mutation

Incidental Mutation 'R5916:Herc6'

461322

Institutional Source

Beutler Lab

Gene Symbol

Herc6

Ensembl Gene

ENSMUSG00000029798

Gene Name

hect domain and RLD 6

Synonyms

Herc5, 1700121D12Rik, CEB1, 2510038N07Rik, 4930427L17Rik

MMRRC Submission

044113-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5916 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57581000-57664632 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 57646203 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Glutamic Acid at position 597 (G597E)

Ref Sequence

ENSEMBL: ENSMUSP00000031817 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031817]

AlphaFold

F2Z461

Predicted Effect

probably benign
Transcript: ENSMUST00000031817
AA Change: G597E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000031817
Gene: ENSMUSG00000029798
AA Change: G597E

Domain	Start	End	E-Value	Type
Pfam:RCC1	40	89	1.9e-12	PFAM
Pfam:RCC1	92	142	4.8e-17	PFAM
Pfam:RCC1_2	129	158	3.4e-14	PFAM
Pfam:RCC1	145	195	1.6e-18	PFAM
Pfam:RCC1_2	183	211	1e-8	PFAM
Pfam:RCC1	198	250	2e-10	PFAM
Pfam:RCC1_2	237	266	4e-10	PFAM
Pfam:RCC1	253	301	4.8e-9	PFAM
low complexity region	359	373	N/A	INTRINSIC
low complexity region	611	626	N/A	INTRINSIC
HECTc	677	1003	1.03e-57	SMART

Coding Region Coverage

1x: 99.8%
3x: 99.3%
10x: 97.2%
20x: 92.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HERC6 belongs to the HERC family of ubiquitin ligases, all of which contain a HECT domain and at least 1 RCC1 (MIM 179710)-like domain (RLD). The 350-amino acid HECT domain is predicted to catalyze the formation of a thioester with ubiquitin before transferring it to a substrate, and the RLD is predicted to act as a guanine nucleotide exchange factor for small G proteins (Hochrainer et al., 2005 [PubMed 15676274]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	C	T	6: 149,326,578	T374I	probably damaging	Het
4930563D23Rik	T	A	16: 92,320,671	E243V	probably damaging	Het
Aadacl4	A	T	4: 144,622,980	N269I	possibly damaging	Het
Abcc1	G	T	16: 14,465,142	V1161F	possibly damaging	Het
Adam3	A	T	8: 24,684,539		probably null	Het
Agt	A	T	8: 124,563,858	S237T	possibly damaging	Het
Ano3	A	T	2: 110,681,836	F674L	probably benign	Het
Asb2	G	T	12: 103,323,876	A504E	probably damaging	Het
Atp13a1	T	A	8: 69,807,098	I1113N	probably damaging	Het
Atxn7l2	T	C	3: 108,205,662		probably null	Het
Bambi	A	G	18: 3,511,463	T95A	probably benign	Het
Ccdc173	A	T	2: 69,789,462	M1K	probably null	Het
Clrn1	T	C	3: 58,846,362	T193A	probably benign	Het
Colgalt2	T	A	1: 152,504,122	D437E	probably damaging	Het
Dchs1	C	A	7: 105,759,166	A1820S	probably damaging	Het
Dnah12	T	A	14: 26,706,918	I233N	possibly damaging	Het
Dsc3	T	C	18: 19,987,020	N194D	probably damaging	Het
Dync2h1	A	G	9: 7,102,309		probably null	Het
Erich3	A	T	3: 154,695,823	R36S	probably damaging	Het
Fmnl3	A	T	15: 99,321,828	C680S	probably damaging	Het
Focad	T	C	4: 88,357,541	L1129P	unknown	Het
Fzd3	G	A	14: 65,202,729	T664I	probably benign	Het
Glb1l3	T	C	9: 26,854,736	I129V	probably benign	Het
Heatr1	T	C	13: 12,434,471	F1950S	probably damaging	Het
Hmcn2	T	A	2: 31,396,139	V2101D	probably damaging	Het
Il17re	T	A	6: 113,470,123	C612S	probably damaging	Het
Il1f9	T	G	2: 24,192,794	*194E	probably null	Het
Junb	T	C	8: 84,977,876	Y185C	probably benign	Het
Lrriq1	G	A	10: 103,221,382	Q186*	probably null	Het
Lrrn2	T	A	1: 132,937,800	V201E	probably damaging	Het
Ly6l	A	T	15: 75,451,178	T68S	probably benign	Het
March1	G	T	8: 66,387,111	R182L	possibly damaging	Het
Megf6	A	G	4: 154,249,425		probably null	Het
Mga	T	A	2: 119,964,312	S2708T	probably benign	Het
Mx1	T	C	16: 97,451,733	T396A	probably benign	Het
Naip5	A	C	13: 100,222,701	S676A	probably benign	Het
Npepl1	G	T	2: 174,121,544	W456C	probably benign	Het
Ntrk2	A	G	13: 58,808,729	M1V	probably null	Het
Nufip1	T	C	14: 76,134,900	*485Q	probably null	Het
Ocln	T	G	13: 100,506,179	D216A	possibly damaging	Het
Olfr108	C	T	17: 37,445,679	L53F	probably benign	Het
Olfr1308	A	G	2: 111,960,830	M81T	probably damaging	Het
Olfr417	A	T	1: 174,369,132	T72S	probably damaging	Het
Olfr544	G	A	7: 102,484,379	S247F	probably damaging	Het
Papd4	T	C	13: 93,175,547	D215G	probably damaging	Het
Ptprq	A	T	10: 107,523,513	M2243K	probably damaging	Het
Rad51b	C	T	12: 79,325,082	Q190*	probably null	Het
Rfx8	T	C	1: 39,688,619	Y182C	probably benign	Het
Rpgrip1l	C	A	8: 91,252,913	R967L	possibly damaging	Het
Scube2	A	G	7: 109,831,724	Y423H	possibly damaging	Het
Sipa1l2	A	T	8: 125,468,573	Y809N	probably damaging	Het
Slc35f1	C	A	10: 52,933,221	Y101*	probably null	Het
Tbc1d22a	A	G	15: 86,214,608	K12E	possibly damaging	Het
Tmcc2	C	T	1: 132,357,691	V646M	probably damaging	Het
Tpp1	A	T	7: 105,749,380	M243K	probably damaging	Het
Trappc12	A	G	12: 28,691,514	L732P	probably damaging	Het
U2af2	A	T	7: 5,079,180		probably null	Het
Utrn	T	A	10: 12,665,051	N1877Y	probably damaging	Het
Vsir	C	T	10: 60,358,037	T93I	probably damaging	Het
Zkscan5	T	A	5: 145,205,302	M3K	possibly damaging	Het
Zscan29	G	T	2: 121,164,037	T489N	probably damaging	Het

Other mutations in Herc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Herc6	APN	6	57607145	missense	probably benign	0.03
IGL00836:Herc6	APN	6	57619549	missense	probably damaging	0.98
IGL01289:Herc6	APN	6	57598623	missense	probably damaging	1.00
IGL01631:Herc6	APN	6	57604107	missense	probably benign	0.03
IGL02656:Herc6	APN	6	57611836	critical splice donor site	probably null
IGL02966:Herc6	APN	6	57583333	critical splice donor site	probably null
IGL03297:Herc6	APN	6	57662389	missense	probably benign	0.03
IGL02835:Herc6	UTSW	6	57646161	missense	possibly damaging	0.94
R0218:Herc6	UTSW	6	57619601	missense	probably benign	0.00
R0470:Herc6	UTSW	6	57619452	missense	probably damaging	1.00
R0699:Herc6	UTSW	6	57581107	missense	probably damaging	1.00
R0702:Herc6	UTSW	6	57581107	missense	probably damaging	1.00
R0707:Herc6	UTSW	6	57662362	missense	possibly damaging	0.81
R0850:Herc6	UTSW	6	57583242	missense	possibly damaging	0.84
R1067:Herc6	UTSW	6	57662219	missense	probably damaging	1.00
R1740:Herc6	UTSW	6	57652065	missense	probably benign
R1840:Herc6	UTSW	6	57658106	nonsense	probably null
R1889:Herc6	UTSW	6	57662075	nonsense	probably null
R1938:Herc6	UTSW	6	57625941	missense	probably damaging	1.00
R2024:Herc6	UTSW	6	57583332	missense	probably benign	0.04
R2051:Herc6	UTSW	6	57625976	missense	probably benign	0.00
R2238:Herc6	UTSW	6	57654401	missense	probably benign	0.05
R2244:Herc6	UTSW	6	57598617	nonsense	probably null
R4085:Herc6	UTSW	6	57647069	missense	probably benign	0.09
R4410:Herc6	UTSW	6	57659679	missense	possibly damaging	0.82
R4490:Herc6	UTSW	6	57654495	missense	probably damaging	1.00
R4599:Herc6	UTSW	6	57659713	missense	probably benign	0.34
R4716:Herc6	UTSW	6	57598438	missense	probably damaging	1.00
R4757:Herc6	UTSW	6	57600060	critical splice donor site	probably null
R4761:Herc6	UTSW	6	57662900	missense	probably benign	0.01
R4798:Herc6	UTSW	6	57604166	missense	probably damaging	1.00
R4826:Herc6	UTSW	6	57647087	missense	probably benign	0.00
R5520:Herc6	UTSW	6	57647120	missense	possibly damaging	0.51
R5545:Herc6	UTSW	6	57658007	critical splice acceptor site	probably null
R5664:Herc6	UTSW	6	57618684	missense	probably benign
R5763:Herc6	UTSW	6	57662887	missense	probably damaging	1.00
R6115:Herc6	UTSW	6	57583206	missense	probably benign	0.01
R6225:Herc6	UTSW	6	57662154	missense	possibly damaging	0.50
R7287:Herc6	UTSW	6	57651980	splice site	probably null
R7319:Herc6	UTSW	6	57604089	missense	probably damaging	1.00
R7375:Herc6	UTSW	6	57651806	splice site	probably null
R7480:Herc6	UTSW	6	57581221	missense	possibly damaging	0.66
R7485:Herc6	UTSW	6	57581104	missense	probably benign	0.00
R7670:Herc6	UTSW	6	57660122	missense	probably damaging	1.00
R7740:Herc6	UTSW	6	57659817	splice site	probably null
R7914:Herc6	UTSW	6	57607121	missense	probably benign	0.03
R8356:Herc6	UTSW	6	57598563	missense	probably benign	0.02
R8403:Herc6	UTSW	6	57583206	missense	probably benign	0.01
R8456:Herc6	UTSW	6	57598563	missense	probably benign	0.02
R8473:Herc6	UTSW	6	57647114	missense	probably damaging	0.99
R8696:Herc6	UTSW	6	57647149	missense	probably benign	0.00
R8751:Herc6	UTSW	6	57662374	missense	probably damaging	1.00
R9023:Herc6	UTSW	6	57618627	missense	probably benign	0.01
R9112:Herc6	UTSW	6	57619619	missense	probably damaging	1.00
R9176:Herc6	UTSW	6	57659678	missense	probably benign	0.01
R9210:Herc6	UTSW	6	57662365	missense	probably damaging	1.00
R9390:Herc6	UTSW	6	57625970	nonsense	probably null
R9427:Herc6	UTSW	6	57659737	missense	probably damaging	1.00
R9530:Herc6	UTSW	6	57625914	nonsense	probably null
R9581:Herc6	UTSW	6	57658116	missense	probably damaging	1.00
R9612:Herc6	UTSW	6	57652032	missense	probably benign
Z1176:Herc6	UTSW	6	57600031	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCAGTCACTGACAAATGTATATATG -3'
(R):5'- AATGAAGCACCTCCTCTTCCTT -3'

Sequencing Primer
(F):5'- CTGTCAACTTCCAGAAAGTG -3'
(R):5'- GAGGCCTCCATTTGTTCTAAGCAAG -3'

Posted On

2017-02-28