Incidental Mutation 'R5916:Scube2'
ID461331
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Namesignal peptide, CUB domain, EGF-like 2
SynonymsICRFP703N2430Q5.1, 4932442O19Rik, Cegf1, ICRFP703B1614Q5.1
MMRRC Submission 044113-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.442) question?
Stock #R5916 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location109798676-109865679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109831724 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 423 (Y423H)
Ref Sequence ENSEMBL: ENSMUSP00000102339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
Predicted Effect probably benign
Transcript: ENSMUST00000007423
AA Change: Y423H

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: Y423H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106728
AA Change: Y423H

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: Y423H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106729
AA Change: Y423H

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: Y423H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132113
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,326,578 T374I probably damaging Het
4930563D23Rik T A 16: 92,320,671 E243V probably damaging Het
Aadacl4 A T 4: 144,622,980 N269I possibly damaging Het
Abcc1 G T 16: 14,465,142 V1161F possibly damaging Het
Adam3 A T 8: 24,684,539 probably null Het
Agt A T 8: 124,563,858 S237T possibly damaging Het
Ano3 A T 2: 110,681,836 F674L probably benign Het
Asb2 G T 12: 103,323,876 A504E probably damaging Het
Atp13a1 T A 8: 69,807,098 I1113N probably damaging Het
Atxn7l2 T C 3: 108,205,662 probably null Het
Bambi A G 18: 3,511,463 T95A probably benign Het
Ccdc173 A T 2: 69,789,462 M1K probably null Het
Clrn1 T C 3: 58,846,362 T193A probably benign Het
Colgalt2 T A 1: 152,504,122 D437E probably damaging Het
Dchs1 C A 7: 105,759,166 A1820S probably damaging Het
Dnah12 T A 14: 26,706,918 I233N possibly damaging Het
Dsc3 T C 18: 19,987,020 N194D probably damaging Het
Dync2h1 A G 9: 7,102,309 probably null Het
Erich3 A T 3: 154,695,823 R36S probably damaging Het
Fmnl3 A T 15: 99,321,828 C680S probably damaging Het
Focad T C 4: 88,357,541 L1129P unknown Het
Fzd3 G A 14: 65,202,729 T664I probably benign Het
Glb1l3 T C 9: 26,854,736 I129V probably benign Het
Heatr1 T C 13: 12,434,471 F1950S probably damaging Het
Herc6 G A 6: 57,646,203 G597E probably benign Het
Hmcn2 T A 2: 31,396,139 V2101D probably damaging Het
Il17re T A 6: 113,470,123 C612S probably damaging Het
Il1f9 T G 2: 24,192,794 *194E probably null Het
Junb T C 8: 84,977,876 Y185C probably benign Het
Lrriq1 G A 10: 103,221,382 Q186* probably null Het
Lrrn2 T A 1: 132,937,800 V201E probably damaging Het
Ly6l A T 15: 75,451,178 T68S probably benign Het
March1 G T 8: 66,387,111 R182L possibly damaging Het
Megf6 A G 4: 154,249,425 probably null Het
Mga T A 2: 119,964,312 S2708T probably benign Het
Mx1 T C 16: 97,451,733 T396A probably benign Het
Naip5 A C 13: 100,222,701 S676A probably benign Het
Npepl1 G T 2: 174,121,544 W456C probably benign Het
Ntrk2 A G 13: 58,808,729 M1V probably null Het
Nufip1 T C 14: 76,134,900 *485Q probably null Het
Ocln T G 13: 100,506,179 D216A possibly damaging Het
Olfr108 C T 17: 37,445,679 L53F probably benign Het
Olfr1308 A G 2: 111,960,830 M81T probably damaging Het
Olfr417 A T 1: 174,369,132 T72S probably damaging Het
Olfr544 G A 7: 102,484,379 S247F probably damaging Het
Papd4 T C 13: 93,175,547 D215G probably damaging Het
Ptprq A T 10: 107,523,513 M2243K probably damaging Het
Rad51b C T 12: 79,325,082 Q190* probably null Het
Rfx8 T C 1: 39,688,619 Y182C probably benign Het
Rpgrip1l C A 8: 91,252,913 R967L possibly damaging Het
Sipa1l2 A T 8: 125,468,573 Y809N probably damaging Het
Slc35f1 C A 10: 52,933,221 Y101* probably null Het
Tbc1d22a A G 15: 86,214,608 K12E possibly damaging Het
Tmcc2 C T 1: 132,357,691 V646M probably damaging Het
Tpp1 A T 7: 105,749,380 M243K probably damaging Het
Trappc12 A G 12: 28,691,514 L732P probably damaging Het
U2af2 A T 7: 5,079,180 probably null Het
Utrn T A 10: 12,665,051 N1877Y probably damaging Het
Vsir C T 10: 60,358,037 T93I probably damaging Het
Zkscan5 T A 5: 145,205,302 M3K possibly damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109808454 missense probably damaging 1.00
IGL01608:Scube2 APN 7 109843254 missense probably benign
IGL02080:Scube2 APN 7 109852478 missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109809180 missense probably benign 0.22
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0106:Scube2 UTSW 7 109846908 splice site probably benign
R0230:Scube2 UTSW 7 109824764 critical splice donor site probably null
R0255:Scube2 UTSW 7 109824872 missense probably damaging 0.98
R0427:Scube2 UTSW 7 109824837 missense probably benign 0.00
R0612:Scube2 UTSW 7 109804764 splice site probably benign
R0658:Scube2 UTSW 7 109837120 splice site probably benign
R0687:Scube2 UTSW 7 109829128 missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1366:Scube2 UTSW 7 109804614 missense probably damaging 1.00
R1635:Scube2 UTSW 7 109843214 missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1972:Scube2 UTSW 7 109809214 missense probably benign 0.16
R2080:Scube2 UTSW 7 109808505 missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109825459 missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109804701 missense probably damaging 1.00
R2325:Scube2 UTSW 7 109843954 missense probably damaging 1.00
R3723:Scube2 UTSW 7 109808406 splice site probably benign
R3887:Scube2 UTSW 7 109843176 splice site probably benign
R3946:Scube2 UTSW 7 109857590 missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109831771 missense probably benign 0.09
R4621:Scube2 UTSW 7 109800650 missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109810713 missense probably damaging 0.96
R4736:Scube2 UTSW 7 109831205 missense probably benign 0.01
R5096:Scube2 UTSW 7 109799244 utr 3 prime probably benign
R5266:Scube2 UTSW 7 109809230 missense probably damaging 1.00
R5579:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R5669:Scube2 UTSW 7 109825439 missense probably benign 0.04
R5838:Scube2 UTSW 7 109808444 missense probably damaging 1.00
R6056:Scube2 UTSW 7 109833013 nonsense probably null
R6731:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R6785:Scube2 UTSW 7 109810617 missense probably benign
Z1177:Scube2 UTSW 7 109838127 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109843201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAGGAGCCTGAGAAGTACC -3'
(R):5'- AAATGACTGTCAACCATGTGAC -3'

Sequencing Primer
(F):5'- TGTTAAAGACCAGCTGCTGC -3'
(R):5'- ATGACTGTCAACCATGTGACTCATC -3'
Posted On2017-02-28