Incidental Mutation 'R5916:Heatr1'
ID 461352
Institutional Source Beutler Lab
Gene Symbol Heatr1
Ensembl Gene ENSMUSG00000050244
Gene Name HEAT repeat containing 1
Synonyms B130016L12Rik
MMRRC Submission 044113-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.964) question?
Stock # R5916 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 12410256-12453774 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 12449352 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 1950 (F1950S)
Ref Sequence ENSEMBL: ENSMUSP00000054084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059270] [ENSMUST00000099820] [ENSMUST00000099821] [ENSMUST00000124888] [ENSMUST00000135166] [ENSMUST00000143693]
AlphaFold G3X9B1
Predicted Effect probably damaging
Transcript: ENSMUST00000059270
AA Change: F1950S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054084
Gene: ENSMUSG00000050244
AA Change: F1950S

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:U3snoRNP10 238 354 7e-30 PFAM
SCOP:d1qbkb_ 919 1795 3e-8 SMART
low complexity region 1805 1814 N/A INTRINSIC
BP28CT 1856 2009 2.25e-77 SMART
Blast:BP28CT 2015 2061 2e-15 BLAST
coiled coil region 2109 2137 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099820
SMART Domains Protein: ENSMUSP00000097408
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099821
SMART Domains Protein: ENSMUSP00000097409
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124888
SMART Domains Protein: ENSMUSP00000115094
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
GLECT 16 151 3.05e-50 SMART
Gal-bind_lectin 22 150 7.41e-55 SMART
GLECT 184 316 1.38e-48 SMART
Gal-bind_lectin 190 315 1.28e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133143
Predicted Effect probably benign
Transcript: ENSMUST00000135166
SMART Domains Protein: ENSMUSP00000120210
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143693
SMART Domains Protein: ENSMUSP00000118925
Gene: ENSMUSG00000057554

DomainStartEndE-ValueType
Pfam:Gal-bind_lectin 1 57 4e-16 PFAM
GLECT 91 223 1.38e-48 SMART
Gal-bind_lectin 97 222 1.28e-49 SMART
Predicted Effect unknown
Transcript: ENSMUST00000222091
AA Change: F550S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221616
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.2%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,349,550 (GRCm39) N269I possibly damaging Het
Abcc1 G T 16: 14,283,006 (GRCm39) V1161F possibly damaging Het
Adam3 A T 8: 25,174,555 (GRCm39) probably null Het
Agt A T 8: 125,290,597 (GRCm39) S237T possibly damaging Het
Ano3 A T 2: 110,512,181 (GRCm39) F674L probably benign Het
Asb2 G T 12: 103,290,135 (GRCm39) A504E probably damaging Het
Atp13a1 T A 8: 70,259,748 (GRCm39) I1113N probably damaging Het
Atxn7l2 T C 3: 108,112,978 (GRCm39) probably null Het
Bambi A G 18: 3,511,463 (GRCm39) T95A probably benign Het
Cfap210 A T 2: 69,619,806 (GRCm39) M1K probably null Het
Clrn1 T C 3: 58,753,783 (GRCm39) T193A probably benign Het
Colgalt2 T A 1: 152,379,873 (GRCm39) D437E probably damaging Het
Dchs1 C A 7: 105,408,373 (GRCm39) A1820S probably damaging Het
Dnah12 T A 14: 26,428,073 (GRCm39) I233N possibly damaging Het
Dsc3 T C 18: 20,120,077 (GRCm39) N194D probably damaging Het
Dync2h1 A G 9: 7,102,309 (GRCm39) probably null Het
Erich3 A T 3: 154,401,460 (GRCm39) R36S probably damaging Het
Fam243 T A 16: 92,117,559 (GRCm39) E243V probably damaging Het
Fmnl3 A T 15: 99,219,709 (GRCm39) C680S probably damaging Het
Focad T C 4: 88,275,778 (GRCm39) L1129P unknown Het
Fzd3 G A 14: 65,440,178 (GRCm39) T664I probably benign Het
Glb1l3 T C 9: 26,766,032 (GRCm39) I129V probably benign Het
Herc6 G A 6: 57,623,188 (GRCm39) G597E probably benign Het
Hmcn2 T A 2: 31,286,151 (GRCm39) V2101D probably damaging Het
Il17re T A 6: 113,447,084 (GRCm39) C612S probably damaging Het
Il36g T G 2: 24,082,806 (GRCm39) *194E probably null Het
Junb T C 8: 85,704,505 (GRCm39) Y185C probably benign Het
Lrriq1 G A 10: 103,057,243 (GRCm39) Q186* probably null Het
Lrrn2 T A 1: 132,865,538 (GRCm39) V201E probably damaging Het
Ly6l A T 15: 75,323,027 (GRCm39) T68S probably benign Het
Marchf1 G T 8: 66,839,763 (GRCm39) R182L possibly damaging Het
Megf6 A G 4: 154,333,882 (GRCm39) probably null Het
Mga T A 2: 119,794,793 (GRCm39) S2708T probably benign Het
Mx1 T C 16: 97,252,933 (GRCm39) T396A probably benign Het
Naip5 A C 13: 100,359,209 (GRCm39) S676A probably benign Het
Npepl1 G T 2: 173,963,337 (GRCm39) W456C probably benign Het
Ntrk2 A G 13: 58,956,543 (GRCm39) M1V probably null Het
Nufip1 T C 14: 76,372,340 (GRCm39) *485Q probably null Het
Ocln T G 13: 100,642,687 (GRCm39) D216A possibly damaging Het
Or10x1 A T 1: 174,196,698 (GRCm39) T72S probably damaging Het
Or1o11 C T 17: 37,756,570 (GRCm39) L53F probably benign Het
Or4f57 A G 2: 111,791,175 (GRCm39) M81T probably damaging Het
Or55b4 G A 7: 102,133,586 (GRCm39) S247F probably damaging Het
Ptprq A T 10: 107,359,374 (GRCm39) M2243K probably damaging Het
Rad51b C T 12: 79,371,856 (GRCm39) Q190* probably null Het
Resf1 C T 6: 149,228,076 (GRCm39) T374I probably damaging Het
Rfx8 T C 1: 39,727,779 (GRCm39) Y182C probably benign Het
Rpgrip1l C A 8: 91,979,541 (GRCm39) R967L possibly damaging Het
Scube2 A G 7: 109,430,931 (GRCm39) Y423H possibly damaging Het
Sipa1l2 A T 8: 126,195,312 (GRCm39) Y809N probably damaging Het
Slc35f1 C A 10: 52,809,317 (GRCm39) Y101* probably null Het
Tbc1d22a A G 15: 86,098,809 (GRCm39) K12E possibly damaging Het
Tent2 T C 13: 93,312,055 (GRCm39) D215G probably damaging Het
Tmcc2 C T 1: 132,285,429 (GRCm39) V646M probably damaging Het
Tpp1 A T 7: 105,398,587 (GRCm39) M243K probably damaging Het
Trappc12 A G 12: 28,741,513 (GRCm39) L732P probably damaging Het
U2af2 A T 7: 5,082,179 (GRCm39) probably null Het
Utrn T A 10: 12,540,795 (GRCm39) N1877Y probably damaging Het
Vsir C T 10: 60,193,816 (GRCm39) T93I probably damaging Het
Zkscan5 T A 5: 145,142,112 (GRCm39) M3K possibly damaging Het
Zscan29 G T 2: 120,994,518 (GRCm39) T489N probably damaging Het
Other mutations in Heatr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Heatr1 APN 13 12,425,331 (GRCm39) missense probably benign 0.00
IGL00863:Heatr1 APN 13 12,450,009 (GRCm39) missense probably benign 0.02
IGL00899:Heatr1 APN 13 12,450,057 (GRCm39) missense probably benign 0.31
IGL01147:Heatr1 APN 13 12,452,793 (GRCm39) missense probably damaging 0.99
IGL01317:Heatr1 APN 13 12,413,908 (GRCm39) missense probably damaging 1.00
IGL01323:Heatr1 APN 13 12,413,819 (GRCm39) missense possibly damaging 0.86
IGL01625:Heatr1 APN 13 12,428,409 (GRCm39) missense probably damaging 0.98
IGL01973:Heatr1 APN 13 12,444,680 (GRCm39) missense probably benign
IGL02803:Heatr1 APN 13 12,448,867 (GRCm39) missense probably damaging 0.96
IGL02830:Heatr1 APN 13 12,441,093 (GRCm39) missense possibly damaging 0.57
IGL02956:Heatr1 APN 13 12,430,940 (GRCm39) missense possibly damaging 0.53
IGL03000:Heatr1 APN 13 12,449,292 (GRCm39) missense probably damaging 0.99
IGL03024:Heatr1 APN 13 12,422,390 (GRCm39) unclassified probably benign
IGL03035:Heatr1 APN 13 12,428,100 (GRCm39) splice site probably benign
IGL03301:Heatr1 APN 13 12,449,086 (GRCm39) missense probably damaging 1.00
hasan UTSW 13 12,432,328 (GRCm39) splice site probably benign
H8562:Heatr1 UTSW 13 12,423,594 (GRCm39) missense probably benign 0.13
R0226:Heatr1 UTSW 13 12,425,443 (GRCm39) missense probably damaging 1.00
R0571:Heatr1 UTSW 13 12,445,121 (GRCm39) missense probably damaging 0.98
R0722:Heatr1 UTSW 13 12,420,918 (GRCm39) missense probably benign 0.14
R1264:Heatr1 UTSW 13 12,439,491 (GRCm39) unclassified probably benign
R1371:Heatr1 UTSW 13 12,432,513 (GRCm39) missense possibly damaging 0.80
R1388:Heatr1 UTSW 13 12,432,328 (GRCm39) splice site probably benign
R1396:Heatr1 UTSW 13 12,420,927 (GRCm39) missense possibly damaging 0.86
R1519:Heatr1 UTSW 13 12,427,040 (GRCm39) missense probably benign
R1689:Heatr1 UTSW 13 12,439,506 (GRCm39) missense probably benign 0.00
R1696:Heatr1 UTSW 13 12,438,602 (GRCm39) missense possibly damaging 0.96
R1756:Heatr1 UTSW 13 12,411,341 (GRCm39) missense probably benign 0.01
R1859:Heatr1 UTSW 13 12,418,040 (GRCm39) missense probably damaging 1.00
R1932:Heatr1 UTSW 13 12,450,066 (GRCm39) missense probably damaging 1.00
R1957:Heatr1 UTSW 13 12,411,419 (GRCm39) missense probably damaging 1.00
R2018:Heatr1 UTSW 13 12,429,359 (GRCm39) missense possibly damaging 0.68
R2106:Heatr1 UTSW 13 12,426,939 (GRCm39) missense probably benign 0.03
R2119:Heatr1 UTSW 13 12,447,527 (GRCm39) missense probably null 1.00
R2121:Heatr1 UTSW 13 12,418,145 (GRCm39) missense probably benign 0.10
R2122:Heatr1 UTSW 13 12,418,145 (GRCm39) missense probably benign 0.10
R2367:Heatr1 UTSW 13 12,448,605 (GRCm39) missense probably damaging 1.00
R3777:Heatr1 UTSW 13 12,428,229 (GRCm39) missense possibly damaging 0.92
R3783:Heatr1 UTSW 13 12,449,341 (GRCm39) missense probably damaging 1.00
R3784:Heatr1 UTSW 13 12,449,341 (GRCm39) missense probably damaging 1.00
R3786:Heatr1 UTSW 13 12,449,341 (GRCm39) missense probably damaging 1.00
R3787:Heatr1 UTSW 13 12,449,341 (GRCm39) missense probably damaging 1.00
R3843:Heatr1 UTSW 13 12,450,002 (GRCm39) missense probably benign 0.00
R4533:Heatr1 UTSW 13 12,449,392 (GRCm39) missense probably benign 0.05
R4725:Heatr1 UTSW 13 12,439,543 (GRCm39) nonsense probably null
R4763:Heatr1 UTSW 13 12,445,811 (GRCm39) missense possibly damaging 0.65
R4793:Heatr1 UTSW 13 12,446,718 (GRCm39) missense probably benign 0.00
R4797:Heatr1 UTSW 13 12,426,929 (GRCm39) missense probably benign 0.36
R4798:Heatr1 UTSW 13 12,426,929 (GRCm39) missense probably benign 0.36
R4942:Heatr1 UTSW 13 12,428,391 (GRCm39) critical splice acceptor site probably null
R4952:Heatr1 UTSW 13 12,425,480 (GRCm39) missense probably benign 0.38
R4954:Heatr1 UTSW 13 12,422,397 (GRCm39) critical splice acceptor site probably null
R5370:Heatr1 UTSW 13 12,416,403 (GRCm39) missense probably benign 0.02
R5464:Heatr1 UTSW 13 12,448,524 (GRCm39) missense probably benign 0.00
R5483:Heatr1 UTSW 13 12,413,795 (GRCm39) missense probably damaging 1.00
R5497:Heatr1 UTSW 13 12,435,945 (GRCm39) missense possibly damaging 0.93
R5504:Heatr1 UTSW 13 12,421,500 (GRCm39) missense possibly damaging 0.64
R5527:Heatr1 UTSW 13 12,419,829 (GRCm39) missense probably benign
R5527:Heatr1 UTSW 13 12,417,641 (GRCm39) missense probably damaging 1.00
R5836:Heatr1 UTSW 13 12,423,617 (GRCm39) missense probably damaging 0.99
R6018:Heatr1 UTSW 13 12,420,939 (GRCm39) missense probably benign 0.26
R6018:Heatr1 UTSW 13 12,419,828 (GRCm39) missense probably benign
R6216:Heatr1 UTSW 13 12,447,545 (GRCm39) missense probably benign 0.16
R6396:Heatr1 UTSW 13 12,420,978 (GRCm39) missense possibly damaging 0.86
R6472:Heatr1 UTSW 13 12,449,111 (GRCm39) missense probably benign 0.29
R6922:Heatr1 UTSW 13 12,449,956 (GRCm39) missense probably benign 0.00
R7077:Heatr1 UTSW 13 12,433,045 (GRCm39) missense possibly damaging 0.63
R7297:Heatr1 UTSW 13 12,435,941 (GRCm39) nonsense probably null
R7445:Heatr1 UTSW 13 12,445,919 (GRCm39) missense possibly damaging 0.70
R7669:Heatr1 UTSW 13 12,426,143 (GRCm39) missense probably benign 0.33
R7672:Heatr1 UTSW 13 12,453,545 (GRCm39) missense probably damaging 0.96
R7772:Heatr1 UTSW 13 12,432,522 (GRCm39) missense probably benign 0.03
R8205:Heatr1 UTSW 13 12,430,928 (GRCm39) missense probably benign
R8518:Heatr1 UTSW 13 12,425,415 (GRCm39) missense probably benign
R8754:Heatr1 UTSW 13 12,428,175 (GRCm39) missense probably damaging 0.99
R8874:Heatr1 UTSW 13 12,445,793 (GRCm39) missense probably damaging 1.00
R8992:Heatr1 UTSW 13 12,415,995 (GRCm39) missense probably damaging 0.98
R9045:Heatr1 UTSW 13 12,428,233 (GRCm39) missense probably benign 0.00
R9077:Heatr1 UTSW 13 12,428,247 (GRCm39) missense probably benign
R9183:Heatr1 UTSW 13 12,436,266 (GRCm39) missense probably damaging 0.99
R9186:Heatr1 UTSW 13 12,436,227 (GRCm39) missense probably damaging 1.00
R9223:Heatr1 UTSW 13 12,419,802 (GRCm39) missense probably benign 0.00
R9242:Heatr1 UTSW 13 12,448,806 (GRCm39) missense probably benign
R9267:Heatr1 UTSW 13 12,421,489 (GRCm39) missense probably damaging 1.00
R9289:Heatr1 UTSW 13 12,447,608 (GRCm39) missense probably benign 0.13
R9310:Heatr1 UTSW 13 12,453,491 (GRCm39) missense probably benign
R9312:Heatr1 UTSW 13 12,446,565 (GRCm39) missense probably benign
R9358:Heatr1 UTSW 13 12,433,087 (GRCm39) missense probably benign 0.09
R9385:Heatr1 UTSW 13 12,421,423 (GRCm39) missense probably damaging 1.00
R9530:Heatr1 UTSW 13 12,439,607 (GRCm39) missense probably damaging 1.00
R9532:Heatr1 UTSW 13 12,429,306 (GRCm39) missense possibly damaging 0.72
R9647:Heatr1 UTSW 13 12,441,679 (GRCm39) missense probably benign 0.00
R9683:Heatr1 UTSW 13 12,449,140 (GRCm39) missense probably damaging 1.00
R9695:Heatr1 UTSW 13 12,438,624 (GRCm39) missense probably damaging 1.00
RF011:Heatr1 UTSW 13 12,422,425 (GRCm39) missense probably benign 0.00
Z1176:Heatr1 UTSW 13 12,413,889 (GRCm39) missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AGAGGTCACATTCAGGCCTCTC -3'
(R):5'- TGGCAAAGTAAAAGTTCACCATCC -3'

Sequencing Primer
(F):5'- AGGCCTCTCTTCTTCAAGGTGAG -3'
(R):5'- GTAAAAGTTCACCATCCTTACACC -3'
Posted On 2017-02-28